Entry information : CsuLiP02(LiP2)
Entry ID 9647
Creation 2011-11-04 (Christophe Dunand)
Last sequence changes 2011-11-04 (Christophe Dunand)
Sequence status complete
Reviewer Catherine
Last annotation changes 2019-05-10 (Catherine )
Peroxidase information: CsuLiP02(LiP2)
Name CsuLiP02(LiP2)
Class Lignin peroxidase    [Orthogroup: LiP006]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Ceriporiopsis
Organism Ceriporiopsis subvermispora    [TaxId: 42742 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsuLiP02
start..stop
S start..stop
CsuLiP01 498 3e-178 1..364 1..364
GsppCIIBB07 493 2e-176 1..362 1..363
PcriCIIBB05 485 2e-173 1..362 1..356
PcriCIIBB07 483 1e-172 1..362 1..357
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 492395..492455 61 N° 2 492135..492339 205 N° 3 492014..492081 68 N° 4 491894..491960 67
N° 5 491773..491840 68 N° 6 491706..491717 12 N° 7 491611..491652 42 N° 8 491477..491555 79
N° 9 491299..491424 126 N° 10 491169..491238 70 N° 11 491071..491116 46 N° 12 490916..491013 98
N° 13 490790..490864 75 N° 14 490667..490731 65 N° 15 490596..490608 13  
complement(join(490596..490608,490667..490731,490790..490864,490916..491013,4910 71..491116,491169..491238,491299..491424,491477..491555,491611..491652,491706..4 91717,491773..491840,491894..491960,492014..492081,492135..492339,492395..492455 ))


exon

Literature and cross-references CsuLiP02(LiP2)
DNA ref. JGI genome:   scaffold_20 (492455..490596)
Cluster/Prediction ref. JGI gene:   118677
Protein sequence: CsuLiP02(LiP2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   364 (343)
PWM (Da):   %s   37507.41 (35450.3)  
PI (pH):   %s   3.86 (3.86) Peptide Signal:   %s   cut: 22 range:22-364
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFSILASLVSVLVVLQAASGAITRKATCPDGNTVTNEACCFLFPILEDIQANLFNGGECGSEAHESLRLTFHDAIGFSPALTAQGQFGGGGADGSVITFASIETAYAANGIEDIVAEQAQFVAKYNVSAGDFVQFAGAVGLSNCPGAPQLDFVGRPAATAASPDGLVPEPFDNVTSILARFNDAGGFDPQHVVWLLSSHSVAAAELVDPSIPGAPFDSTPGLFDTQFFIETQLTGTLWPGTANNQGEVESPLLGEIRLQSDFLARDNRTACEWQSFANDLSRQQTLFKAAMSTLATIGQDTSTLTDCSDIPVPAAPVGTPHFPAGLTNADVDQACTTAAFPTLSTDPGPATSVAPVPTA

Retrieve as FASTA  
Remarks Complete sequence from genomic (14 introns). Extra seq at the end of second exon confirmed with RNAseq data
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCTCAATCCTCGCATCCCTTGTCTCTGTGCTCGTGGTTCTCCAGGCTGCCAGTGGTACTGAATTCTGCTCATACACTGTATGGACGGACACTGAATAACTATTATTCAGGTGC
TATTACCCGCAAGGCGACCTGTCCTGACGGTAACACGGTCACTAATGAGGCCTGCTGCTTCCTCTTCCCAATTCTCGAGGATATTCAGGCGAACCTGTTCAATGGTGGCGAGTGCGGCTC
GGAGGCGCACGAGTCTCTCCGACTCACCTTCCACGATGCCATCGGCTTTTCCCCTGCACTCACTGCCCAGGGACAATTTGG
GTATGCTTCGATGTTCTTCGTTACGTTCGCGTTTAGTGA
CGCTTTAACCTCAGTGGCGGAGGTGCTGATGGCTCCGTTATTACATTCGCGTCGATCGAGACTGCCTATGCAGCGAACGCTGGTATGCATTCAATCGCGAACATCTGCTTCTCATTCTAA
TATCGAATATTCTAGGCATCGAGGATATTGTGGCAGAGCAGGCACAATTTGTTGCGAAATACAATGTTTCCGCCGGAGACTTGTGAGCCCATTAATCGACTCGATCTTGAGAATTCACTG
ATAGTGGGATATCAGCGTTCAATTTGCGGGCGCTGTCGGACTGAGCAACTGCCCGGGTGCGCCTCAGCTTGACTTCGTGATCGGTCAGTAAACGGCAATGATTTAACCAAGAATCACGTG
CTGACGCTGGCACCGCAGGTCGTCCTGCAGGTACACGATCAATTCTAGATTAACGAAAGTATAGTATCTAAGCATCGATCTAGCTACCGCGGCCTCTCCTGACGGTCTCGTACCGGAGCC
TTTCG
GTATGTCGTTCACGTTCGCTGTATGAATAAATCCACTAACGCGACACAACCACAGATAACGTGACAAGCATTCTTGCGCGCTTCAACGATGCGGGCGGTTTTGATCCTCAGCACG
TTGTCTGGCTGCTGTCTTC
GTGAGTTCTCTCTGGCGTTGATAAAGAGACGGGGATTCTAAGTGGGCGAAAGGCATTCGGTTGCCGCCGCGGAGCTAGTTGACCCCTCGATCCCCGGCGCA
CCATTTGACTCAACTCCCGGTCTGTTCGACACGCAGTTTTTCATTGAGACCCAACTCACTGGCACTCTCTGGCCCGG
GTACGCTGATTCTGTTATCTGTATTCAGGCCATATCTAAATAC
CGCTTCCTGCTCATTAGTACTGCTAACAACCAGGGCGAGGTCGAGTCTCCCCTCCTGGGAGAGATCCGTCTCCAGTCCGACTTCTTGGTTCGTATGCTCGTCAGTCATCCTCTGCCGAGA
TTCTAACGCATTCGCGCAGCTCGCCCGCGATAACCGAACTGCATGCGAATGGCAGTCCTTCGCTAGTGAGTGCAAGTTCCGACTTTCCAATATGACCATATGCTCACCGGGATTCTACCC
AGACGACTTGAGCAGGCAGCAGACCCTGTTCAAGGCCGCGATGAGCACCCTCGCTACGATCGGCCAGGATACTAGCACACTTACGGACTGCTCTGACGTCGTACGTCTCATCATGTTCTC
GTATTTCTGCCGTCTGCTTGACTCTTTGCAGATCCCGGTACCGGCTGCGCCCGTGGGCACGCCTCACTTCCCCGCTGGCCTGACAAATGCTGATGTCGACCAAGCGGTGCGTTTCAGTTG
TGCGCTGTCGTAGATTACGCTCTTATGTTGATATCGTCACACAGTGCACTACCGCCGCATTCCCGACTCTCTCAACAGATCCTGGTCCGGCGACCTCCGTTGCTCCTGTGTAAGTCAGCG
TCCGAGCTTCTCTATGGAATACATTGATGACGGTCTCTTTCCTTTAGACCCACTGCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCTCAATCCTCGCATCCCTTGTCTCTGTGCTCGTGGTTCTCCAGGCTGCCAGTGGTGCTATTACCCGCAAGGCGACCTGTCCTGACGGTAACACGGTCACTAATGAGGCCTGC
TGCTTCCTCTTCCCAATTCTCGAGGATATTCAGGCGAACCTGTTCAATGGTGGCGAGTGCGGCTCGGAGGCGCACGAGTCTCTCCGACTCACCTTCCACGATGCCATCGGCTTTTCCCCT
GCACTCACTGCCCAGGGACAATTTGG
TGGCGGAGGTGCTGATGGCTCCGTTATTACATTCGCGTCGATCGAGACTGCCTATGCAGCGAACGCTGGCATCGAGGATATTGTGGCAGAGCAG
GCACAATTTGTTGCGAAATACAATGTTTCCGCCGGAGACTT
CGTTCAATTTGCGGGCGCTGTCGGACTGAGCAACTGCCCGGGTGCGCCTCAGCTTGACTTCGTGATCGGTCGTCCTGCA
G
CTACCGCGGCCTCTCCTGACGGTCTCGTACCGGAGCCTTTCGATAACGTGACAAGCATTCTTGCGCGCTTCAACGATGCGGGCGGTTTTGATCCTCAGCACGTTGTCTGGCTGCTGTCT
TC
GCATTCGGTTGCCGCCGCGGAGCTAGTTGACCCCTCGATCCCCGGCGCACCATTTGACTCAACTCCCGGTCTGTTCGACACGCAGTTTTTCATTGAGACCCAACTCACTGGCACTCTC
TGGCCCGG
TACTGCTAACAACCAGGGCGAGGTCGAGTCTCCCCTCCTGGGAGAGATCCGTCTCCAGTCCGACTTCTTGCTCGCCCGCGATAACCGAACTGCATGCGAATGGCAGTCCTTC
GCTA
ACGACTTGAGCAGGCAGCAGACCCTGTTCAAGGCCGCGATGAGCACCCTCGCTACGATCGGCCAGGATACTAGCACACTTACGGACTGCTCTGACGTCATCCCGGTACCGGCTGCG
CCCGTGGGCACGCCTCACTTCCCCGCTGGCCTGACAAATGCTGATGTCGACCAAGCG
TGCACTACCGCCGCATTCCCGACTCTCTCAACAGATCCTGGTCCGGCGACCTCCGTTGCTCCT
GT
ACCCACTGCTTGA

Retrieve as FASTA