Entry information : CsuMnP12 (MnP12)
Entry ID 9649
Creation 2011-11-04 (Christophe Dunand)
Last sequence changes 2016-06-24 (Catherine Mathe)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-06-24 (Catherine Mathe)
Peroxidase information: CsuMnP12 (MnP12)
Name (synonym) CsuMnP12 (MnP12)
Class Manganese peroxidase    [Orthogroup: MnP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Ceriporiopsis
Organism Ceriporiopsis subvermispora    [TaxId: 42742 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsuMnP12
start..stop
S start..stop
CsuMnP03 650 0 1..386 1..386
CsuMnP06 625 0 1..386 1..383
CsuMnP01 619 0 15..386 15..386
PbreMnP07 599 0 1..386 1..381
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 950381..950509 129 N° 2 950270..950321 52 N° 3 950191..950217 27 N° 4 950095..950134 40
N° 5 949848..950025 178 N° 6 949568..949789 222 N° 7 949085..949511 427 N° 8 948929..949032 104
complement(join(948929..949032,949085..949511,949568..949789,949848..950025,9500 95..950134,950191..950217,950270..950321,950381..950509))


exon

Literature and cross-references CsuMnP12 (MnP12)
DNA ref. JGI genome:   scaffold_11 (950509..948929)
Protein sequence: CsuMnP12 (MnP12)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   393 (374)
PWM (Da):   %s   40764.86 (38883.8)  
PI (pH):   %s   3.93 (3.90) Peptide Signal:   %s   cut: 19 range:19-392
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFPALLALVALAASVRAAPASSSAVCSDGTIVSNAVCCDFIPLAQDLQSMVLQNDCGEDAHEIIRLTFHDAIPISRSLGPSAGGGADGSMLIFPLVEPEFFASNGIDDSVNNLIPFLSSHPTISAGDLVQFAGAVALSNCPGAPRATFFAGRPNATAPAIDGLIPEPQDNVTSILARFDDAGGFTPFEVVSLLASHTIARADKVDPTLDAAPFDTTPFTFDTQFFLETLLKGVGFPGTDDNVGEVASPLPLGDTSTGGNDTGMMRLQSDFVLARDERTACFWQSFVNQQDLMAESFKAAFFKLSLLGHNQADLVDCSEVVPIPVPGDGKPATFPATTGPQDLQLTCTAERFPTLSVDPGATETLVPHCSDGGENCPSVQFAGPATGFNGTD*

Retrieve as FASTA  
Remarks Complete sequence from genomic (7 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCCCTGCTCTCCTCGCTCTCGTGGCCCTCGCCGCGAGTGTGCGTGCTGCACCCGCCTCCAGCTCTGCTGTCTGCTCGGACGGCACTATCGTTAGCAATGCTGTGTGCTGCGAC
TTCATCCCG
GTATGCTCGTTATGCTTGTGTAATTCGATGTTCATTCATGATAGTATGTCTCGTTTTAGCTCGCCCAGGACCTGCAGTCCATGGTATTGCAGAACGACTGCGGTGAAGACG
GTATGCTTAACAAAAATATGTTACATCCTGAATGCACTGACAACCATCACAGCACACGAAATCATCCGGCTAACTTTCCGTTAGTATAATACCCGTTTTTCAATTCGAATAAAGAGTGAC
ATCGAAATCCTGTAGACGACGCCATTCCGATCTCCCGCTCCCTGGGTCCTTCTGCGTGCGTCATTATAAGGCTTGAATTTCTCGCTGGACGAACGGGAGCACTGACATCTCGAATATCAT
GCAGTGGCGGAGGAGCCGATGGCTCGATGCTCATCTTCCCGCTCGTTGAGCCCGAGTTCTTCGCCAGCAATGGTATCGACGACTCCGTCAACAACTTGATCCCCTTCCTGTCCAGCCACC
CGACCATCTCGGCTGGTGACCTTGTCCAGTTCGCCGGCGCCGTCGCGCTTTCTAACTGCCCT
GTTAGTTCCTGCATACAATTTTGCTTACCTGACCGCATGACTGATTCACACTTTACAG

GGCGCTCCGCGCGCTACGTTCTTTGCGGGCCGTCCGAACGCAACTGCTCCTGCTATTGATGGTTTGATCCCCGAGCCTCAGGACAATGTGACCAGCATCCTCGCCCGTTTCGATGATGCA
GGAGGCTTCACGCCGTTCGAGGTCGTCTCCCTCCTGGCTTCGCACACTATCGCTCGTGCCGACAAGGTTGACCCGACCCTTGACGCTGCGCCTTTCGACACT
GTGAGTAGTTCCAGCGTT
TTCCATTCTCTCATGATCATTAAATACGGCACTCCCAGACTCCTTTCACATTCGATACGCAGTTCTTCCTCGAGACCCTCCTCAAGGGCGTCGGGTTCCCCGGAACTGACGATAATGTCG
GTGAGGTCGCGTCCCCGCTCCCTCTCGGTGACACTTCGACCGGCGGCAACGACACCGGCATGATGCGCCTGCAATCCGACTTCGTCCTTGCGCGCGACGAGCGCACCGCTTGCTTCTGGC
AGAGCTTCGTCAACCAACAGGATTTGATGGCCGAGAGCTTCAAGGCTGCGTTCTTCAAGCTTTCCCTCCTCGGACACAACCAGGCGGACCTTGTTGACTGCTCGGAGGTCGTGCCCATTC
CCGTGCCCGGGGACGGCAAACCTGCGACCTTCCCCGCCACGACTGGCCCGCAGGATCTCCAACTCACCTGCACGGCCGAGCGCTTCCCTACCCTCAGCGTTGACC
GTAAGTGCATTGTTT
CTGAGCAATTTCGACACTTGTCTTATATGGAATTTAGCCGGTGCAACTGAGACCCTCGTTCCGCACTGCTCCGACGGCGGAGAGAATTGCCCATCCGTCCAGTTTGCAGGCCCTGCCACC
GGCTTCAATGGCACTGACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCCCTGCTCTCCTCGCTCTCGTGGCCCTCGCCGCGAGTGTGCGTGCTGCACCCGCCTCCAGCTCTGCTGTCTGCTCGGACGGCACTATCGTTAGCAATGCTGTGTGCTGCGAC
TTCATCCCG
CTCGCCCAGGACCTGCAGTCCATGGTATTGCAGAACGACTGCGGTGAAGACGCACACGAAATCATCCGGCTAACTTTCCACGACGCCATTCCGATCTCCCGCTCCCTGGGT
CCTTCTGC
TGGCGGAGGAGCCGATGGCTCGATGCTCATCTTCCCGCTCGTTGAGCCCGAGTTCTTCGCCAGCAATGGTATCGACGACTCCGTCAACAACTTGATCCCCTTCCTGTCCAGC
CACCCGACCATCTCGGCTGGTGACCTTGTCCAGTTCGCCGGCGCCGTCGCGCTTTCTAACTGCCCT
GGCGCTCCGCGCGCTACGTTCTTTGCGGGCCGTCCGAACGCAACTGCTCCTGCT
ATTGATGGTTTGATCCCCGAGCCTCAGGACAATGTGACCAGCATCCTCGCCCGTTTCGATGATGCAGGAGGCTTCACGCCGTTCGAGGTCGTCTCCCTCCTGGCTTCGCACACTATCGCT
CGTGCCGACAAGGTTGACCCGACCCTTGACGCTGCGCCTTTCGACACT
ACTCCTTTCACATTCGATACGCAGTTCTTCCTCGAGACCCTCCTCAAGGGCGTCGGGTTCCCCGGAACTGAC
GATAATGTCGGTGAGGTCGCGTCCCCGCTCCCTCTCGGTGACACTTCGACCGGCGGCAACGACACCGGCATGATGCGCCTGCAATCCGACTTCGTCCTTGCGCGCGACGAGCGCACCGCT
TGCTTCTGGCAGAGCTTCGTCAACCAACAGGATTTGATGGCCGAGAGCTTCAAGGCTGCGTTCTTCAAGCTTTCCCTCCTCGGACACAACCAGGCGGACCTTGTTGACTGCTCGGAGGTC
GTGCCCATTCCCGTGCCCGGGGACGGCAAACCTGCGACCTTCCCCGCCACGACTGGCCCGCAGGATCTCCAACTCACCTGCACGGCCGAGCGCTTCCCTACCCTCAGCGTTGACC
CCGGT
GCAACTGAGACCCTCGTTCCGCACTGCTCCGACGGCGGAGAGAATTGCCCATCCGTCCAGTTTGCAGGCCCTGCCACCGGCTTCAATGGCACTGACTGA

Retrieve as FASTA