Entry information : CsuMnP07 (MnP7)
Entry ID 9650
Creation 2011-11-04 (Christophe Dunand)
Last sequence changes 2011-11-04 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-02 (Catherine Mathe (Scipio))
Peroxidase information: CsuMnP07 (MnP7)
Name (synonym) CsuMnP07 (MnP7)
Class Manganese peroxidase    [Orthogroup: MnP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Ceriporiopsis
Organism Ceriporiopsis subvermispora    [TaxId: 42742 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsuMnP07
start..stop
S start..stop
CsuMnP03 615 0 1..382 1..385
CsuMnP08 610 0 1..382 1..383
CsuMnP12 608 0 1..382 1..385
CsuMnP02 608 0 1..382 1..382
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1239358..1239477 120 N° 2 1239253..1239304 52 N° 3 1239128..1239194 67 N° 4 1238892..1239069 178
N° 5 1238618..1238839 222 N° 6 1238128..1238554 427 N° 7 1237989..1238071 83  
complement(join(1237989..1238071,1238128..1238554,1238618..1238839,1238892..1239 069,1239128..1239194,1239253..1239304,1239358..1239477))


exon

Literature and cross-references CsuMnP07 (MnP7)
DNA ref. JGI genome:   scaffold_6 (1239477..1237989)
Protein sequence: CsuMnP07 (MnP7)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   382 (364)
PWM (Da):   %s   39758.36 (37972.3)  
PI (pH):   %s   3.87 (3.83) Peptide Signal:   %s   cut: 19 range:19-382
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFTALLALATIAATVRAAPAAICSDGTVVSNSVCCDFVPLATALQSTLFMNDCGEDAHESIRLMFHDAVSISQSQGPSAGGGADGSMLIFPTIEPNFPANNGIDDSVNNLIPFLSMFPTISAGDLVQFAGAVALTNCGAPRLEFLAGRANATAPAVIGLIPQPQDNVTSILDRFADAGNFSPFEVVSLLASHSVARADKVDPTLDASPFDTTPFTFDTQFFLETLLKGVGFPGLDNNTGEVASPLPLGDTASGGNDTGMMRLQSDFLLARDERTACFWQSFVNEQDFMTQSFKSAVEKLAILGSNRADLIDCSDVVPIAMPAAGVPATFPATTGPRDLQLTCLTEQFPSLTVDPGATETLVPHCSDGSEDCPTVQFSGPA

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCACTGCACTCCTCGCTCTCGCTACCATTGCCGCAACTGTGCGCGCTGCACCGGCCGCGATTTGTTCCGACGGCACTGTCGTTAGCAACTCTGTCTGCTGCGACTTCGTTCCG
GTATGGTTATTATCGCTCGAATCTGGGAGCGTGGCTAAAGTATTGTATTTTAGCTCGCGACAGCGCTGCAGAGCACCCTGTTCATGAATGACTGTGGTGAAGATGGTCAGTACCACCGCT
ATCGAAGTGTTTCCGCTCAGATATTCATGACGTTGGCCTGAAGCACACGAGTCCATTCGCTTGATGTTCCACGACGCCGTTTCGATCTCTCAAAGTCAGGGACCCTCTGCGTATGTCTAC
TTTTTTTCTGTAAACGAGGAATTGCACTGATGAATTGATGGATCTCAGTGGTGGCGGAGCCGACGGCTCCATGCTCATCTTCCCCACCATTGAGCCAAACTTCCCAGCTAACAACGGTAT
CGACGACTCGGTGAACAACTTGATCCCGTTCCTCTCCATGTTCCCGACTATCAGTGCTGGTGACCTCGTCCAATTCGCCGGTGCTGTCGCTCTCACCAACTGCCCC
GTGAGTATAGTTTC
CCGCACAAAGATGTTATATTCACGACTGTCCATCATAGGGTGCCCCCCGGCTCGAGTTTTTGGCTGGCCGCGCAAACGCGACTGCTCCCGCTGTTATTGGGCTGATTCCGCAGCCACAGG
ACAACGTTACGAGCATTCTCGACCGCTTTGCTGACGCGGGCAACTTCTCGCCATTCGAAGTCGTCTCGCTCCTGGCCTCGCATTCCGTCGCCCGTGCAGACAAGGTCGACCCTACCCTCG
ATGCTTCACCCTTCGACACG
GTCAGTGCCTAGTGCTCTCGTATGGTGTACGTATCTTCTGACACCTTGACCTCTATGCTATAGACCCCCTTCACTTTCGATACTCAGTTCTTCCTTGAGA
CCCTCCTGAAGGGTGTCGGGTTCCCTGGACTCGACAACAACACTGGTGAAGTGGCGTCACCCCTGCCGCTCGGAGACACGGCTAGCGGTGGCAACGACACTGGCATGATGCGCCTCCAGT
CCGACTTCCTCCTTGCCCGCGACGAGCGCACCGCGTGCTTCTGGCAGAGCTTCGTCAACGAGCAAGACTTCATGACGCAGAGCTTCAAGTCTGCCGTCGAGAAGCTTGCTATCCTCGGCT
CCAACCGCGCTGACCTGATTGACTGCTCGGACGTCGTCCCCATCGCGATGCCCGCCGCCGGCGTACCCGCGACGTTCCCCGCTACCACCGGCCCCCGGGACCTCCAGCTCACCTGTTTGA
CCGAACAGTTCCCGTCGCTCACCGTTGACC
GTGAGTATACCTCATACTGGAGGAAGTGTTGTGCATTGTCTGACACGATTGTACAGCCGGCGCGACGGAGACCCTTGTTCCTCACTGCTC
TGACGGCAGCGAGGACTGCCCGACTGTGCAGTTCAGTGGTCCGGCTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCACTGCACTCCTCGCTCTCGCTACCATTGCCGCAACTGTGCGCGCTGCACCGGCCGCGATTTGTTCCGACGGCACTGTCGTTAGCAACTCTGTCTGCTGCGACTTCGTTCCG
CTCGCGACAGCGCTGCAGAGCACCCTGTTCATGAATGACTGTGGTGAAGATGCACACGAGTCCATTCGCTTGATGTTCCACGACGCCGTTTCGATCTCTCAAAGTCAGGGACCCTCTGCT
GGTGGCGGAGCCGACGGCTCCATGCTCATCTTCCCCACCATTGAGCCAAACTTCCCAGCTAACAACGGTATCGACGACTCGGTGAACAACTTGATCCCGTTCCTCTCCATGTTCCCGACT
ATCAGTGCTGGTGACCTCGTCCAATTCGCCGGTGCTGTCGCTCTCACCAACTGCCCC
GGTGCCCCCCGGCTCGAGTTTTTGGCTGGCCGCGCAAACGCGACTGCTCCCGCTGTTATTGGG
CTGATTCCGCAGCCACAGGACAACGTTACGAGCATTCTCGACCGCTTTGCTGACGCGGGCAACTTCTCGCCATTCGAAGTCGTCTCGCTCCTGGCCTCGCATTCCGTCGCCCGTGCAGAC
AAGGTCGACCCTACCCTCGATGCTTCACCCTTCGACACG
ACCCCCTTCACTTTCGATACTCAGTTCTTCCTTGAGACCCTCCTGAAGGGTGTCGGGTTCCCTGGACTCGACAACAACACT
GGTGAAGTGGCGTCACCCCTGCCGCTCGGAGACACGGCTAGCGGTGGCAACGACACTGGCATGATGCGCCTCCAGTCCGACTTCCTCCTTGCCCGCGACGAGCGCACCGCGTGCTTCTGG
CAGAGCTTCGTCAACGAGCAAGACTTCATGACGCAGAGCTTCAAGTCTGCCGTCGAGAAGCTTGCTATCCTCGGCTCCAACCGCGCTGACCTGATTGACTGCTCGGACGTCGTCCCCATC
GCGATGCCCGCCGCCGGCGTACCCGCGACGTTCCCCGCTACCACCGGCCCCCGGGACCTCCAGCTCACCTGTTTGACCGAACAGTTCCCGTCGCTCACCGTTGACC
CCGGCGCGACGGAG
ACCCTTGTTCCTCACTGCTCTGACGGCAGCGAGGACTGCCCGACTGTGCAGTTCAGTGGTCCGGCTTAG

Retrieve as FASTA