Entry information : PgigLiP01
Entry ID 9657
Creation 2011-11-08 (Christophe Dunand)
Last sequence changes 2011-11-08 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-28 (Christophe Dunand)
Peroxidase information: PgigLiP01
Name PgigLiP01
Class Lignin peroxidase    [Orthogroup: LiP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Phanerochaetaceae Phlebiopsis
Organism Phlebiopsis gigantea    [TaxId: 82310 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PgigLiP01
start..stop
S start..stop
PgigLiP02 640 0 1..363 1..363
PcLiP02_RP78 546 0 1..366 1..372
PcLiP05_BKMF1767 544 0 1..362 1..368
PcarLiP01 544 0 1..366 1..372
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 32175..32226 52 N° 2 31915..32122 208 N° 3 31641..31855 215 N° 4 31538..31579 42
N° 5 31411..31489 79 N° 6 31238..31363 126 N° 7 30896..31187 292 N° 8 30778..30842 65
N° 9 30704..30725 22  
complement(join(30704..30725,30778..30842,30896..31187,31238..31363,31411..31489 ,31538..31579,31641..31855,31915..32122,32175..32226))


exon

Literature and cross-references PgigLiP01
DNA ref. JGI genome:   scaffold_183 (32226..30704)
Protein sequence: PgigLiP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   366 (346)
PWM (Da):   %s   38606.91 (36599.8)  
PI (pH):   %s   4.23 (4.14) Peptide Signal:   %s   cut: 21 range:21-366
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALKHLFITISAALVANAAAVSKRATCSTGQTVSNAACCAWFPVLEDIQQNMFAGGQCNAEAHESLRLVFHDGIAISPAMEARGEFGGGGADGSIMLFDTIETAFHPNIGLDEIVNIQKPFVQKHGVNPADFIPFAGAVAVSNCPGAPEMQFFTGRKATQAAPDGLVPEPFHTVDQILARTNDAGGFDELETVWMLSAHSIAASNDVDPTVQGLPFDSTPEQFDGQFFLDTQLRGVLFPGSGGNQGEVESAIAGEIRLQSDHLIARDSRTACEWQSFVNNQTKLQDDFQFIFTAIATLGQDMDALVDCSDVIPAPQPQNFGATRFPPGKTNADIEQCAATPFPTLATVPGLATSVARIPPPPGA

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCACTCAAGCACCTTTTCATCACCATCTCCGCCGCCCTGGTCGCCAACGGTGAGCACTTCACTTGCTCCATAACGCGTATGCACTAACCTTCATGCACTAGCTGCCGCCGTCTCGAA
GCGCGCGACCTGCTCGACTGGCCAGACCGTCTCGAACGCAGCGTGCTGTGCATGGTTCCCAGTCCTCGAGGACATCCAGCAGAACATGTTTGCTGGTGGCCAGTGCAACGCCGAGGCGCA
TGAGTCGCTCCGCCTCGTCTTCCACGACGGCATCGCCATCTCGCCCGCCATGGAGGCGCGCGGTGAGTTCGG
GTGGGTTCTTTCCCCTTCCCTCGCGAATAGTTACGCGCTGACGTGGGT
GCGGACTGCAGCGGCGGCGGCGCGGACGGGAGTATCATGCTTTTCGACACGATCGAGACCGCGTTCCACCCCAACATCGGCCTCGACGAGATCGTCAACATCCAGAAGCCCTTCGTGCAG
AAGCACGGCGTGAACCCGGCTGATTTCATACCCTTTGCTGGCGCGGTCGCCGTCAGCAACTGCCCCGGTGCGCCCGAGATGCAGTTCTTCACCGGCCGCAAGATCG
GTGAGCCACGCGCA
GAATTCCAGTCGGAATGCATGGCGGCTGCTGACACACGCGCATCTAGCCACACAGGCCGCGCCTGACGGTCTCGTCCCCGAGCCCTTCCGTACGTACTGCCCGCTCTGGTGTGGCTGCCG
CTGAAGATCCGCCGCAGACACCGTCGACCAGATCCTCGCCCGCACGAACGACGCCGGCGGATTCGACGAGCTCGAGACCGTCTGGATGCTCTCTGCGTAAGTTCTGCGCCTTTACACGGT
GGGGGTGACCTTACTGCGTATAGCCACTCGATCGCTGCGTCCAACGACGTCGACCCGACCGTGCAGGGCCTGCCGTTCGACTCGACGCCGGAACAGTTTGACGGCCAGTTCTTCCTCGAC
ACGCAGCTGCGAGGCGTGCTATTCCCCGG
GTAGGCCCTTGCCCATCCCCTCTGACACCAGACGCTGAGCGTGCATACAGCTCGGGAGGGAACCAAGGCGAGGTGGAGTCAGCCATAGCGG
GCGAGATCCGCCTGCAGAGCGACCACCTGATCGCGCGTGACTCGCGCACGGCTTGCGAGTGGCAGTCGTTTGTGAACAACCAGACGAAGCTGCAGGACGACTTCCAGTTCATCTTCACCG
CCATCGCGACGCTCGGCCAGGACATGGACGCCCTCGTCGACTGCTCCGACGTCATCCCCGCGCCACAGCCCCAGAACTTCGGCGCCACGCGCTTCCCCCCTGGCAAGACGAACGCCGACA
TTGAGCAGGCG
GTGAGTGTGACGCGCCGTCGAGGAATCATGGGGTACTGACGCGAGCTTTGCAGTGCGCCGCGACGCCCTTCCCGACCCTCGCGACGGTACCCGGCCTCGCGACCTCTGT
CGCCCGCAT
GTGAGTGTGGTTCTTAGTCCGCAGCCGAGAGCGTAATCTTATGCGCCTACAGCCCTCCCCCTCCTGGTGCTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCACTCAAGCACCTTTTCATCACCATCTCCGCCGCCCTGGTCGCCAACGCTGCCGCCGTCTCGAAGCGCGCGACCTGCTCGACTGGCCAGACCGTCTCGAACGCAGCGTGCTGTGCA
TGGTTCCCAGTCCTCGAGGACATCCAGCAGAACATGTTTGCTGGTGGCCAGTGCAACGCCGAGGCGCATGAGTCGCTCCGCCTCGTCTTCCACGACGGCATCGCCATCTCGCCCGCCATG
GAGGCGCGCGGTGAGTTCGG
CGGCGGCGGCGCGGACGGGAGTATCATGCTTTTCGACACGATCGAGACCGCGTTCCACCCCAACATCGGCCTCGACGAGATCGTCAACATCCAGAAGCCC
TTCGTGCAGAAGCACGGCGTGAACCCGGCTGATTTCATACCCTTTGCTGGCGCGGTCGCCGTCAGCAACTGCCCCGGTGCGCCCGAGATGCAGTTCTTCACCGGCCGCAAGATCG
CCACA
CAGGCCGCGCCTGACGGTCTCGTCCCCGAGCCCTTCC
ACACCGTCGACCAGATCCTCGCCCGCACGAACGACGCCGGCGGATTCGACGAGCTCGAGACCGTCTGGATGCTCTCTGCCCAC
TCGATCGCTGCGTCCAACGACGTCGACCCGACCGTGCAGGGCCTGCCGTTCGACTCGACGCCGGAACAGTTTGACGGCCAGTTCTTCCTCGACACGCAGCTGCGAGGCGTGCTATTCCCC
GG
CTCGGGAGGGAACCAAGGCGAGGTGGAGTCAGCCATAGCGGGCGAGATCCGCCTGCAGAGCGACCACCTGATCGCGCGTGACTCGCGCACGGCTTGCGAGTGGCAGTCGTTTGTGAAC
AACCAGACGAAGCTGCAGGACGACTTCCAGTTCATCTTCACCGCCATCGCGACGCTCGGCCAGGACATGGACGCCCTCGTCGACTGCTCCGACGTCATCCCCGCGCCACAGCCCCAGAAC
TTCGGCGCCACGCGCTTCCCCCCTGGCAAGACGAACGCCGACATTGAGCAGGCG
TGCGCCGCGACGCCCTTCCCGACCCTCGCGACGGTACCCGGCCTCGCGACCTCTGTCGCCCGCATC
CCTCCCCCTCCTGGTGCTTAG

Retrieve as FASTA