Entry information : PgigLiP02
Entry ID 9658
Creation 2011-11-08 (Christophe Dunand)
Last sequence changes 2011-11-08 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-27 (Catherine Mathe (Scipio))
Peroxidase information: PgigLiP02
Name PgigLiP02
Class Lignin peroxidase    [Orthogroup: LiP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Phanerochaetaceae Phlebiopsis
Organism Phlebiopsis gigantea    [TaxId: 82310 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PgigLiP02
start..stop
S start..stop
PgigLiP01 628 0 1..363 1..363
PcarLiP01 536 0 1..363 1..369
PcLiP04_RP78 535 0 1..363 1..368
PcLiP04_BKMF1767 530 0 1..363 1..368
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1653..1704 52 N° 2 1763..1970 208 N° 3 2024..2238 215 N° 4 2295..2336 42
N° 5 2387..2465 79 N° 6 2521..2646 126 N° 7 2707..2822 116 N° 8 2877..3052 176
N° 9 3111..3175 65 N° 10 3226..3253 28  
join(1653..1704,1763..1970,2024..2238,2295..2336,2387..2465,2521..2646,2707..282 2,2877..3052,3111..3175,3226..3253)


exon

Literature and cross-references PgigLiP02
DNA ref. JGI genome:   scaffold_106 (1653..3253)
Protein sequence: PgigLiP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   368 (350)
PWM (Da):   %s   38912.08 (37024.0)  
PI (pH):   %s   4.27 (4.18) Peptide Signal:   %s   cut: 19 range:19-368
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSFKQLLVAVSAALLTKSAVIEKRATCATGQTTANAACCAWFPVLEDIQQNMFAGGQCNAEAHEALRLVFHDGIAVSPAMEARGQFGGGGADGSIMLFDEIETAFHPNIGLDDVVALEKPFVAKHGVSPADFIPFAGAVAVSNCAGAPEMQFFIGRKATQAAPDGLVPEPFHTVDQILERTNDAGQFDELETVWMLSAHSIAASNDVDPTVVGLPFDSTPEQFDGQFFLDTQLRGVLFPGSGGNQGEVESAVAGEIRLQSDHNFARDSRTACEWQSFNNQTKLQADFQFIFTAIATLGQDMDSLIDCSDVIPAPKPQNFGPTRFPPGKSNADIEQCAATPFPTLATAPGPATSVARINPPFKVSH

Retrieve as FASTA  
Remarks Complete sequence from genomic (10 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCTTCAAACAATTGCTCGTCGCAGTGTCCGCTGCTCTCCTCACCAAGTGTACGCGCTCCGTTCGCGCCTTCCCATTGCGCACCTGCTAACATGTTCCTCTCGCTAGCTGCGGTCAT
CGAGAAGCGGGCGACGTGCGCGACCGGACAGACGACTGCGAACGCGGCGTGCTGCGCTTGGTTCCCTGTGCTCGAAGACATCCAACAGAACATGTTCGCCGGCGGCCAGTGCAACGCCGA
GGCGCACGAGGCCCTGCGCCTTGTCTTCCACGACGGCATCGCCGTCTCGCCCGCCATGGAGGCACGCGGTCAGTTCGG
GTACGCTCGCTTGCTCTTCACGCGACATGAGTATCGTCTGAC
AGCGGCGGCAGCGGCGGCGGTGCGGACGGCTCTATCATGCTATTTGACGAGATCGAGACTGCGTTCCACCCCAACATCGGCCTCGACGACGTTGTCGCACTCGAGAAGCCCTTTGTGGCG
AAGCACGGCGTGAGCCCCGCCGACTTCATCCCCTTCGCGGGGGCGGTGGCCGTCAGCAACTGCGCCGGTGCTCCGGAGATGCAGTTCTTCATCGGCCGCAAGATTG
GTCAGTACTTTCGG
GATTCTCCCGACTTGAAGACATGTTCATGCTCGTATCTACAGCCACCCAGGCCGCCCCCGACGGCCTCGTCCCAGAGCCCTTCCGCGAGTCCATCTCCGTGTCCTGCTCCGCTTGTGCTA
ATACTATGCTTTAGATACGGTCGACCAGATCCTCGAGCGCACCAATGACGCCGGTCAATTCGACGAGCTTGAAACCGTCTGGATGCTCTCCGCGTACGCCCGCGTCTCGCCCTTGTATCC
GGCCCCCACTGATACCCGTTCGCGCCAGCCACTCGATCGCGGCGTCCAACGACGTCGACCCGACCGTCGTCGGCCTGCCATTTGACTCGACGCCGGAGCAATTTGACGGCCAGTTCTTCC
TTGATACGCAGCTCCGCGGTGTCCTCTTCCCCGG
GTGAGCCCTGCCTCTTCTGCACGATAATATGCTGTATTGCTGAGACGGAGTGTGGTGCAGCTCGGGCGGGAATCAGGGTGAGGTCG
AGTCCGCCGTGGCGGGTGAGATCCGCCTGCAGTCCGACCACAACTTTGCCCGGGACAGCCGCACCGCGTGCGAGTGGCAGTCCTTCGTCA
GTGCGTACCCCTCCTCCATCGTCCTCGCGG
CGCGGCGCTGACGCATGTGTACAGACAACCAGACAAAGCTGCAGGCGGACTTCCAGTTCATCTTCACCGCCATCGCGACGCTCGGCCAGGACATGGACAGCCTCATCGACTGCTCGGACG
TCATTCCCGCGCCCAAGCCCCAGAACTTCGGCCCCACGCGCTTCCCACCCGGCAAGTCGAACGCGGACATCGAGCAGGCC
GTACGTCCGCGCCCATTTGTGCGCCGGGGCATGCTGGCGA
GTGCTGACGATCCGACAGTGTGCGGCCACGCCGTTCCCGACCCTTGCAACTGCGCCCGGCCCTGCGACGAGCGTCGCGCGCATGTGGGTGATTACGTTCGATGGTTAATCGCGCAAGGCT
AACGATACTCTAGCAACCCTCCGTTCAAAGTCAGCCACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCTTCAAACAATTGCTCGTCGCAGTGTCCGCTGCTCTCCTCACCAAGTCTGCGGTCATCGAGAAGCGGGCGACGTGCGCGACCGGACAGACGACTGCGAACGCGGCGTGCTGCGCT
TGGTTCCCTGTGCTCGAAGACATCCAACAGAACATGTTCGCCGGCGGCCAGTGCAACGCCGAGGCGCACGAGGCCCTGCGCCTTGTCTTCCACGACGGCATCGCCGTCTCGCCCGCCATG
GAGGCACGCGGTCAGTTCGG
CGGCGGCGGTGCGGACGGCTCTATCATGCTATTTGACGAGATCGAGACTGCGTTCCACCCCAACATCGGCCTCGACGACGTTGTCGCACTCGAGAAGCCC
TTTGTGGCGAAGCACGGCGTGAGCCCCGCCGACTTCATCCCCTTCGCGGGGGCGGTGGCCGTCAGCAACTGCGCCGGTGCTCCGGAGATGCAGTTCTTCATCGGCCGCAAGATTG
CCACC
CAGGCCGCCCCCGACGGCCTCGTCCCAGAGCCCTTCC
ATACGGTCGACCAGATCCTCGAGCGCACCAATGACGCCGGTCAATTCGACGAGCTTGAAACCGTCTGGATGCTCTCCGCCCAC
TCGATCGCGGCGTCCAACGACGTCGACCCGACCGTCGTCGGCCTGCCATTTGACTCGACGCCGGAGCAATTTGACGGCCAGTTCTTCCTTGATACGCAGCTCCGCGGTGTCCTCTTCCCC
GG
CTCGGGCGGGAATCAGGGTGAGGTCGAGTCCGCCGTGGCGGGTGAGATCCGCCTGCAGTCCGACCACAACTTTGCCCGGGACAGCCGCACCGCGTGCGAGTGGCAGTCCTTCGTCAAC
AACCAGACAAAGCTGCAGGCGGACTTCCAGTTCATCTTCACCGCCATCGCGACGCTCGGCCAGGACATGGACAGCCTCATCGACTGCTCGGACGTCATTCCCGCGCCCAAGCCCCAGAAC
TTCGGCCCCACGCGCTTCCCACCCGGCAAGTCGAACGCGGACATCGAGCAGGCC
TGTGCGGCCACGCCGTTCCCGACCCTTGCAACTGCGCCCGGCCCTGCGACGAGCGTCGCGCGCATC
AACCCTCCGTTCAAAGTCAGCCACTGA

Retrieve as FASTA