Entry information : PgigLiP03
Entry ID 9664
Creation 2011-11-09 (Christophe Dunand)
Last sequence changes 2011-11-09 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-27 (Catherine Mathe (Scipio))
Peroxidase information: PgigLiP03
Name PgigLiP03
Class Lignin peroxidase    [Orthogroup: LiP006]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Phanerochaetaceae Phlebiopsis
Organism Phlebiopsis gigantea    [TaxId: 82310 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PgigLiP03
start..stop
S start..stop
PcLiP04_RP78 495 6e-177 1..362 1..366
PcLiP10_RP78 492 6e-176 1..362 1..364
PcLiP04_BKMF1767 490 4e-175 1..362 1..366
PcLiP03_BKMF1767 462 3e-164 1..362 1..366
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 64907..64958 52 N° 2 64703..64856 154 N° 3 64594..64650 57 N° 4 64312..64526 215
N° 5 64217..64258 42 N° 6 64076..64154 79 N° 7 63898..64023 126 N° 8 63730..63845 116
N° 9 63497..63672 176 N° 10 63377..63441 65 N° 11 63305..63323 19  
complement(join(63305..63323,63377..63441,63497..63672,63730..63845,63898..64023 ,64076..64154,64217..64258,64312..64526,64594..64650,64703..64856,64907..64958))


exon

Literature and cross-references PgigLiP03
DNA ref. JGI genome:   scaffold_75 (64958..63305)
Protein sequence: PgigLiP03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   366 (348)
PWM (Da):   %s   38698.99 (36662.9)  
PI (pH):   %s   4.13 (4.09) Peptide Signal:   %s   cut: 19 range:19-366
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGFRWLFVSAIFAILVQGTPLQRRISCLDGKNSASNILCCPWYSVLDDIQQSLFSGGQCGAEARESLRLVFHDAIAISPALEAEGKFGGGGADGSIIEFASIETNYHANLGLDDIVELQKPFVAKHLVTPGDFIAFAGAVATSNCPGAPQMPFFAGRPPTLPAPDGLVPEPFHSVDQILARVNDAGGFDAQEAVWLLSAHTVAAANQVDPTKQGLPFDSTPGQFDTQFFVETQLRGTSYPGSANNQGEVESPLAGELRLQSDYLFARDPRTACEFQSFDNQDVLQENFQTIFASLTTLGHSVDDLVDCSEVIPASKPANFGHAQLPAGKTMDDVEQCADTPFPTLDTAPGPATSVASVPTSGV

Retrieve as FASTA  
Remarks complete sequence from genomic (10 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGATTCAGATGGCTTTTTGTGTCGGCAATTTTCGCTATCCTCGTCCAAGGTACGTACGAATTTCGTGGCGACGCGTGCAAGTGCTGACACAGTACACAGGAACCCCTTTGCAAAGGC
GTATATCTTGCTTGGATGGGAAGAATAGCGCGTCGAACATACTCTGCTGTCCCTGGTATTCTGTTCTCGACGACATCCAGCAAAGTCTGTTTTCCGGCGGCCAATGTGGTGCTGAAGCTC
GCGAATCCCTCCGTCT
GTGAGTCATATGACCCCTCTTTCCCCACCTGGATTTTCGACCTCAAAATCAGGGTATTCCATGATGCGATTGCAATTTCTCCAGCGCTCGAAGCGGAAGGGAAG
TTTGG
GTACGTCTGTCGCTTCGACTTCCTCCTCATCTCCGCGGGGGCCTGGATTGCTGAAGCCACGTGCTAGCGGCGGTGGGGCAGATGGCTCCATCATCGAGTTCGCCAGCATCGAAAC
TAACTATCACGCAAACCTCGGCCTGGACGACATTGTGGAGCTACAGAAACCCTTTGTCGCCAAACACCTCGTAACACCTGGCGACTTCATCGCGTTTGCGGGTGCCGTCGCAACAAGTAA
CTGCCCTGGCGCGCCTCAAATGCCATTCTTCGCGGGCCGTCCGCTAC
GTAGGGCTCCTTCAATTTCCATATTGCTTCGATAGCACTCACTCCCTGTTCAGCGACCCTTCCAGCTCCAGAC
GGTCTAGTCCCCGAGCCGTTCC
GTAAGTTCCTTTCCATGTGTCGAGAGAGAGAGCGCTCTCAATAACTCCTTCGACCACTGCAGACAGCGTTGATCAAATACTGGCCAGGGTCAATGACG
CGGGTGGATTTGATGCACAGGAGGCCGTGTGGCTTCTTTCCGC
GTATGTAATCACAGTTCAGGGCGACGTCCTAAGCTTATGCCTTCAACTACAGCCATACCGTCGCAGCTGCCAATCAA
GTCGACCCCACCAAGCAAGGCCTGCCATTTGACTCGACCCCCGGTCAATTCGATACACAGTTTTTCGTCGAGACTCAGCTTCGTGGAACATCATATCCTGG
GTGAGTCCCGACGGGCCTT
TGCACATGAGATTACCCTGATCGTAGCTCGTAGATCTGCGAACAACCAGGGAGAAGTCGAGTCTCCTCTGGCAGGCGAACTTCGTCTTCAGTCAGACTATCTCTTCGCTCGCGATCCAAG
GACGGCCTGTGAATTCCAGTCATTCGTCG
GTAGGTGCCATCCGTTTTGGTCGTGCGATGCCTGGGGTTGATGTATCTCACGGTTAGACAATCAAGACGTGCTGCAGGAGAATTTCCAAAC
GATCTTCGCCTCGCTTACAACTCTCGGTCATAGTGTGGACGATTTAGTAGACTGCTCGGAGGTCATTCCTGCGTCCAAACCGGCAAACTTCGGACACGCACAACTCCCTGCTGGAAAGAC
TATGGACGATGTTGAGCAAGCC
GTATGTCTTTGACTTTTTGTACACTCTTTCGTCGAATCTGACATACCGTCTTTAGTGCGCGGACACCCCGTTCCCCACGCTCGATACGGCGCCTGGCC
CTGCTACATCGGTTGCCTCAGT
GTAAGTCGAACATCGTATTCGTGTCACGGCTGCTTATCATGTACCTCTGACAGTCCCACGTCCGGAGTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGATTCAGATGGCTTTTTGTGTCGGCAATTTTCGCTATCCTCGTCCAAGGAACCCCTTTGCAAAGGCGTATATCTTGCTTGGATGGGAAGAATAGCGCGTCGAACATACTCTGCTGT
CCCTGGTATTCTGTTCTCGACGACATCCAGCAAAGTCTGTTTTCCGGCGGCCAATGTGGTGCTGAAGCTCGCGAATCCCTCCGTCT
GGTATTCCATGATGCGATTGCAATTTCTCCAGCG
CTCGAAGCGGAAGGGAAGTTTGG
CGGCGGTGGGGCAGATGGCTCCATCATCGAGTTCGCCAGCATCGAAACTAACTATCACGCAAACCTCGGCCTGGACGACATTGTGGAGCTACAGAAA
CCCTTTGTCGCCAAACACCTCGTAACACCTGGCGACTTCATCGCGTTTGCGGGTGCCGTCGCAACAAGTAACTGCCCTGGCGCGCCTCAAATGCCATTCTTCGCGGGCCGTCCGCTAC
CG
ACCCTTCCAGCTCCAGACGGTCTAGTCCCCGAGCCGTTCC
ACAGCGTTGATCAAATACTGGCCAGGGTCAATGACGCGGGTGGATTTGATGCACAGGAGGCCGTGTGGCTTCTTTCCGCC
CATACCGTCGCAGCTGCCAATCAAGTCGACCCCACCAAGCAAGGCCTGCCATTTGACTCGACCCCCGGTCAATTCGATACACAGTTTTTCGTCGAGACTCAGCTTCGTGGAACATCATAT
CCTGG
ATCTGCGAACAACCAGGGAGAAGTCGAGTCTCCTCTGGCAGGCGAACTTCGTCTTCAGTCAGACTATCTCTTCGCTCGCGATCCAAGGACGGCCTGTGAATTCCAGTCATTCGTC
G
ACAATCAAGACGTGCTGCAGGAGAATTTCCAAACGATCTTCGCCTCGCTTACAACTCTCGGTCATAGTGTGGACGATTTAGTAGACTGCTCGGAGGTCATTCCTGCGTCCAAACCGGCA
AACTTCGGACACGCACAACTCCCTGCTGGAAAGACTATGGACGATGTTGAGCAAGCC
TGCGCGGACACCCCGTTCCCCACGCTCGATACGGCGCCTGGCCCTGCTACATCGGTTGCCTCA
GT
TCCCACGTCCGGAGTGTAA

Retrieve as FASTA