Entry information : GsppVP01(VP1-atypical)
Entry ID 9693
Creation 2011-11-15 (Christophe Dunand)
Last sequence changes 2011-11-15 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2019-05-10 (Catherine )
Peroxidase information: GsppVP01(VP1-atypical)
Name GsppVP01(VP1-atypical)
Class Versatile peroxidase    [Orthogroup: VP001]
Taxonomy Fungi/Metazoa; Fungi; Basidiomycota; Basidiomycota
Organism Ganoderma sp. 10597 SS1    [TaxId: 767862 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GsppVP01
start..stop
S start..stop
GapCIIBA01 654 0 1..364 1..364
GauCIIBA01 653 0 1..364 1..364
GfCIIBA01 625 0 1..364 1..364
TvVP01 551 0 1..364 1..364
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2735416..2735532 117 N° 2 2735317..2735360 44 N° 3 2735211..2735256 46 N° 4 2735091..2735149 59
N° 5 2735025..2735038 14 N° 6 2734843..2734963 121 N° 7 2734552..2734783 232 N° 8 2734320..2734489 170
N° 9 2734225..2734262 38 N° 10 2733932..2734144 213 N° 11 2733849..2733873 25 N° 12 2733772..2733787 16
complement(join(2733772..2733787,2733849..2733873,2733932..2734144,2734225..2734 262,2734320..2734489,2734552..2734783,2734843..2734963,2735025..2735038,2735091. .2735149,2735211..2735256,2735317..2735360,2735416..2735532))


exon

Literature and cross-references GsppVP01(VP1-atypical)
DNA ref. JGI genome:   scaffold_3 (2735532..2733772)
Protein sequence: GsppVP01(VP1-atypical)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   364 (346)
PWM (Da):   %s   37924.29 (36116.3)  
PI (pH):   %s   4.12 (4.08) Peptide Signal:   %s   cut: 19 range:19-364
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFSKAFLTLVVAAASVTAAVPRMGKRATCSNGKTVNNDACCVWFDVLDDIQENLFHGGQCGEDAHEALLTFHDAIGFSPALTAAGQFGGGGDGSIIAHSDVELTYPANNGVDEIVEASRPIAIKHNVSFGDFIQFAGAVGTANCNGGPQLSFFAGRSNDSQPAPPNLVPLPSDSADSILSRFSDAGFDAVEVVWLLVSHTVGSQHTVDSIPGAPFDSTPSDFDAQFFVETMLNGTLVPGNGLQDGEVNSPYPGEFRLQSDFALSRDSRTACEWQKMADRANMLAKFEGVMLKMSLLGFDQSALTDCSDVIPTATGTVQDPFLPAGLTVDDLQPACSSSAFPTVSTVAGAATSIPAVPMDS

Retrieve as FASTA  
Remarks Complete sequence from genomic (11 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCTCCAAGGCTTTCCTCACTCTCGTCGTCGCCGCTGCGTCGGTCACCGCCGCCGTCCCGCGGATGGGCAAGCGTGCCACTTGCAGCAACGGCAAGACGGTCAACAACGATGCGGTA
CACCCCGTTCTTGCCATCCGTGTTTGGCCTCGTAGCTGATGATCGTGCACAGTGCTGTGTCTGGTTCGATGTCCTCGACGACATTCAAGAGAACCTGTAAGTATTGAGCCGCCTTGTTCT
GTGGATAGTGATCGTCGGTCTCACTCCGCTTCGCAGCTTCCATGGCGGGCAGTGCGGGGAAGATGCTCATGAAGCCCTGAGGGTATGTATATCCTAATATCCCTTCGCCGCCACCGGACA
GCTCAATAATTTCGGTTTCGTAGCTTACCTTCCATGACGCGATTGGTTTCTCTCCTGCTCTGACTGCCGCAGGCCAATTCGGGTGAGTTTTGCTCCACCCTCCATTTACATTCATTTGCT
GACTATCAGAACAGCGGCGGAGGTGCTGGTGAGTGCCGATAGGCTATCCTTTTCCACGTATCATGTCTAAATGCTATACATTGCCACAGATGGTTCGATCATTGCGCACTCCGATGTGGA
GTTGACATATCCCGCCAACAACGGTGTGGACGAAATCGTCGAGGCTTCCCGCCCGATCGCCATTAAGCACAACGTCTCCTTCGGCGACTT
GTAAGCTTCCTCTACCGGTGACGCGCCCAA
CCACCGTATGCTGATGACCATCATGATAGCATTCAATTCGCAGGCGCCGTTGGGACTGCGAACTGCAACGGCGGGCCCCAGCTCTCGTTCTTCGCTGGTCGGTCCAACGACTCTCAGCCA
GCTCCTCCGAACCTCGTCCCGCTCCCGTCGGACAGCGCCGACTCGATCCTCTCTCGCTTCTCCGATGCGGGCTTCGACGCGGTCGAGGTCGTATGGCTCCTGGTCTCTCACACGGTCGGC
TCCCAGCACACGGTTGACCCA
GTCAGTTTTCTCCGTCTCCATCCCTCCATGATGATGCTGATGCCCGGTTTCGACCCTGTCAGAGCATCCCGGGCGCGCCGTTCGACTCGACGCCGTCGG
ACTTCGACGCCCAGTTCTTCGTTGAGACGATGCTGAACGGCACGCTCGTCCCCGGTAACGGCCTGCAGGACGGCGAAGTGAACTCGCCCTACCCCGGCGAGTTCCGCCTCCAGTCCGACT
TCGCCCTCTCTCG
GTGAGTGGTGTCCAAACGTGCGCCGCCGTCCTCACCGAGCTCACACGGTCTCAACAGCGACTCTCGGACCGCCTGCGAGTGGCAAAAGATGATCGGTACGTCATGCT
CTTCCTCCCCCATCTAGAGTTCCGACGTCCTCGGCCCGAGTCCCGTGTCTCACTCAGTCTTTCCACAGCCGACCGTGCGAACATGCTGGCGAAGTTCGAGGGCGTGATGCTGAAGATGTC
GCTGCTCGGCTTCGACCAGTCCGCGCTCACCGACTGCTCCGACGTGATCCCCACCGCGACCGGCACGGTCCAGGACCCGTTCCTTCCCGCGGGCCTGACGGTGGACGACCTCCAGCCTGC
GTGCTCGTCGAGCGCCTTCCCCACGGTGTCCACCGTTGCTG
GTACGTCTGTCGAACATTCGATCTGGGAATCTCACCTTCTGACGACTTGGATGTATAGGTGCCGCCACCTCTATCCCTG
CCGT
GTAAGTGTCTCCCGTTATGTTAGAAGATCGGCCGCTTACACTTAAACTTGGTGGTGTGTAGGCCCATGGACTCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCTCCAAGGCTTTCCTCACTCTCGTCGTCGCCGCTGCGTCGGTCACCGCCGCCGTCCCGCGGATGGGCAAGCGTGCCACTTGCAGCAACGGCAAGACGGTCAACAACGATGCGTGC
TGTGTCTGGTTCGATGTCCTCGACGACATTCAAGAGAACCT
CTTCCATGGCGGGCAGTGCGGGGAAGATGCTCATGAAGCCCTGAGGCTTACCTTCCATGACGCGATTGGTTTCTCTCCT
GCTCTGACTGCCGCAGGCCAATTCGG
CGGCGGAGGTGCTGATGGTTCGATCATTGCGCACTCCGATGTGGAGTTGACATATCCCGCCAACAACGGTGTGGACGAAATCGTCGAGGCTTCC
CGCCCGATCGCCATTAAGCACAACGTCTCCTTCGGCGACTT
CATTCAATTCGCAGGCGCCGTTGGGACTGCGAACTGCAACGGCGGGCCCCAGCTCTCGTTCTTCGCTGGTCGGTCCAAC
GACTCTCAGCCAGCTCCTCCGAACCTCGTCCCGCTCCCGTCGGACAGCGCCGACTCGATCCTCTCTCGCTTCTCCGATGCGGGCTTCGACGCGGTCGAGGTCGTATGGCTCCTGGTCTCT
CACACGGTCGGCTCCCAGCACACGGTTGACCCA
AGCATCCCGGGCGCGCCGTTCGACTCGACGCCGTCGGACTTCGACGCCCAGTTCTTCGTTGAGACGATGCTGAACGGCACGCTCGTC
CCCGGTAACGGCCTGCAGGACGGCGAAGTGAACTCGCCCTACCCCGGCGAGTTCCGCCTCCAGTCCGACTTCGCCCTCTCTCG
CGACTCTCGGACCGCCTGCGAGTGGCAAAAGATGATC
G
CCGACCGTGCGAACATGCTGGCGAAGTTCGAGGGCGTGATGCTGAAGATGTCGCTGCTCGGCTTCGACCAGTCCGCGCTCACCGACTGCTCCGACGTGATCCCCACCGCGACCGGCACG
GTCCAGGACCCGTTCCTTCCCGCGGGCCTGACGGTGGACGACCTCCAGCCTGCGTGCTCGTCGAGCGCCTTCCCCACGGTGTCCACCGTTGCTG
GTGCCGCCACCTCTATCCCTGCCGTG
CCCATGGACTCTTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CTCGTATCTC GGAGTCACCA GCCAGGTCAC TTACATCCTT GAACCGCCTC GCTATGTTCT CCAAGGCTTT CCTCACTCTC GTCGTCGCCG CTGCGTCGGT CACCGCCGCC GTCCCGCGGA  TGGGCAAGCG TGCCACTTGC AGCAACGGCA AGACGGTCAA CAACGATGCG TGCTGTGTCT GGTTCGATGT CCTCGACGAC ATTCAAGAGA ACCTCTTCCA TGGCGGGCAG TGCGGGGAAG  ATGCTCATGA AGCCCTGAGG CTTACCTTCC ATGACGCGAT TGGTTTCTCT CCTGCTCTGA CTGCCGCAGG CCAATTCGGC GGCGGAGGTG CTGATGGTTC GATCATTGCG CACTCCGATG  TGGAGTTGAC ATATCCCGCC AACAACGGTG TGGACGAAAT CGTCGAGGCT TCCCGCCCGA TCGCCATTAA GCACAACGTC TCCTTCGGCG ACTTCATTCA ATTCGCAGGC GCCGTTGGGA  CTGCGAACTG CAACGGCGGG CCCCAGCTCT CGTTCTTCGC TGGTCGGTCC AACGACTCTC AGCCAGCTCC TCCGAACCTC GTCCCGCTCC CGTCGGACAG CGCCGACTCG ATCCTCTCTC  GCTTCTCCGA TGCGGGCTTC GACGCGGTCG AGGTCGTATG GCTCCTGGTC TCTCACACGG TCGGCTCCCA GCACACGGTT GACCCAAGCA TCCCGGGCGC GCCGTTCGAC TCGACGCCGT  CGGACTTCGA CGCCCAGTTC TTCGTTGAGA CGATGCTGAA CGGCACGCTC GTCCCCGGTA ACGGCCTGCA GGACGGCGAA GTGAACTCGC CCTACCCCGG CGAGTTCCGC CTCCAGTCCG  ACTTCGCCCT CTCTCGCGAC TCTCGGACCG CCTGCGAGTG GCAAAAGATG ATCGCCGACC GTGCGAACAT GCTGGCGAAG TTCGAGGGCG TGATGCTGAA GATGTCGCTG CTCGGCTTCG  ACCAGTCCGC GCTCACCGAC TGCTCCGACG TGATCCCCAC CGCGACCGGC ACGGTCCAGG ACCCGTTCCT TCCCGCGGGC CTGACGGTGG ACGACCTCCA GCCTGCGTGC TCGTCGAGCG  CCTTCCCCAC GGTGTCCACC GTTGCTGGTG CCGCCACCTC TATCCCTGCC GTGCCCATGG ACTCTTGAAC AATGAGTCGC CATCAGGGAC AGCACCCTCA AGTATTGAAT GGCGGGCTGA 
ACAAGTAGTA TATAGCTTTC TCATGTGGTT TATGGTATAT CGGTTTCGAA TGATGGGTTG TTTGTATTGC GGATTTTTAA TGCGATGCGA TGTGTCACCA T 

Retrieve as FASTA