Entry information : PbreLiP03 (LiP3)
Entry ID 9701
Creation 2011-11-01 (Christophe Dunand)
Last sequence changes 2016-06-07 (Catherine Mathe)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-06-07 (Catherine Mathe)
Peroxidase information: PbreLiP03 (LiP3)
Name (synonym) PbreLiP03 (LiP3)
Class Lignin peroxidase    [Orthogroup: LiP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phlebia
Organism Phlebia brevispora    [TaxId: 194682 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PbreLiP03
start..stop
S start..stop
PrLiP01 577 0 1..362 1..362
PbreLiP04 561 0 1..362 1..362
BaLiP04 521 0 1..362 1..362
PbreLiP02 515 0 1..357 1..353
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1134411..1134471 61 N° 2 1134149..1134356 208 N° 3 1133955..1134089 135 N° 4 1133830..1133897 68
N° 5 1133762..1133773 12 N° 6 1133665..1133706 42 N° 7 1133537..1133615 79 N° 8 1133283..1133478 196
N° 9 1133186..1133231 46 N° 10 1132954..1133126 173 N° 11 1132823..1132891 69  
complement(join(1132823..1132891,1132954..1133126,1133186..1133231,1133283..1133 478,1133537..1133615,1133665..1133706,1133762..1133773,1133830..1133897,1133955. .1134089,1134149..1134356,1134411..1134471))


exon

Literature and cross-references PbreLiP03 (LiP3)
DNA ref. JGI genome:   scaffold_12 (1134471..1132823)
Protein sequence: PbreLiP03 (LiP3)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   363 (341)
PWM (Da):   %s   38714.96 (36524.8)  
PI (pH):   %s   4.09 (4.05) Peptide Signal:   %s   cut: 22 range:22-362
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKQLFAAISTALAITGANAALTRRVACPDGVNTATNAACCNLFTVRDDLQKNLFNGAQCNDEAHEAFRLTFHDAIAFSPALQAQGQFGGGGADGSIVIFSEIETQFHANIGLDEVIAIQKPFLERSNMSVADFIQFAGAVGISNCPGAPQLNAFVGRTDATQPAPDGLVPEPFDTVDTILARFNDAGGFDELETVWFLIAHTVAAQNDIDPTIPRTPFDSTPELFDGQFFIETQLRGTLFPGEGGIQGTVESPMKGEFRLQSDHDLARDSRTACEWQSFGTDQAKLQNRFQFIFEAMGQLGTNPDDLIDCSEVLPVPPQLTTTPHFPAGKTNADVEQACAETPFPTLPSLPGPATPVAPV*

Retrieve as FASTA  
Remarks Complete sequence from genomic (10 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTCAAGCAACTTTTCGCTGCAATCTCCACAGCTCTCGCCATCACTGGTGCAAACGGTGCGCTGAGCTACTTCTCTTTATTCGCGCACATTCGACTGACATACTTTCCAGCTGCC
CTTACTAGGCGTGTAGCTTGCCCCGATGGTGTTAACACCGCCACGAACGCAGCCTGCTGCAACCTCTTCACTGTTCGAGATGACTTGCAGAAGAACCTCTTCAACGGGGCTCAATGCAAT
GACGAGGCTCACGAAGCTTTCCGTCTCACGTTCCACGATGCTATCGCCTTCTCTCCGGCCCTTCAGGCCCAGGGTCAATTCGG
GTCCGCTTGTTTTTACTCAGTCAAGTTTTGCACGTTG
GCTGACCACTGTCGGGTAACAGTGGTGGAGGCGCTGATGGCTCCATCGTCATCTTCTCTGAAATTGAGACTCAGTTCCACGCCAACATCGGTCTGGACGAGGTAATTGCGATCCAGAAGC
CCTTCTTGGAGAGAAGCAACATGAGCGTTGCGGACTT
GTATGGCATCATGACCCTGCTCTCTTTTAAATAACTAACTTCGTTCACTCTGCATAGCATCCAATTTGCCGGTGCTGTCGGCA
TATCCAACTGTCCCGGTGCGCCTCAGCTGAACGCCTTTGTCG
GTACGTCGTATTTCAAACTCCAGTGGATAAGACCAAAATTCTTGAATTTCGTACAGGACGAACGGATGGTGCGCTGCC
CATCTACCCTCCGTAATGACTGATACTTAACTACCTAATTCTCAGCCACCCAGCCGGCTCCGGATGGCCTCGTCCCCGAGCCGTTTGGTACGTATGCCATTCGTACTAGTAATAGGATCT
AAATAATGCTATACAGACACCGTCGACACGATCTTGGCCCGCTTCAACGACGCTGGTGGATTCGATGAGCTCGAGACTGTCTGGTTCTTGATCGCGTTCGTACTCGTTTGTCCGGCCGCA
CTCATAGCCGACTCTGACGAAATCACACACCAGCCACACCGTCGCCGCTCAGAACGACATTGATCCGACCATCCCGCGCACGCCCTTCGACTCCACCCCCGAGCTCTTCGACGGTCAGTT
CTTCATCGAGACTCAGCTGCGCGGCACCCTCTTCCCCGGCGAGGGCGGTATCCAAGGCACCGTCGAGTCTCCCATGAAGGGCGAGTTCCGTCTCCAGTCTGATCACGAC
GTACGCCCCTA
CAATCAGTATCGTCGGCATTCGTGTCTGACCGCTCCTTAGCTCGCTCGTGACTCCAGGACCGCTTGCGAGTGGCAGTCCTTCGGCAGTGAGTACCTGCACCGTTCGCAAGGTGACACACA
GGCCTAATATGGATCTACCCCACAGCCGACCAGGCTAAGCTTCAGAACCGCTTCCAATTCATCTTCGAGGCTATGGGTCAGCTTGGTACCAACCCCGACGACCTCATCGACTGCAGCGAG
GTCCTCCCTGTCCCCCCTCAACTCACGACCACCCCGCACTTCCCCGCTGGCAAGACCAATGCTGATGTTGAGCAGGCC
GTGAGTATCATGTCCCTATCTTGCGCTGCAAGCTGAATGTGA
ACTGACGTTTCCATCTGTAGTGCGCCGAGACTCCGTTCCCCACTCTCCCCTCCCTCCCTGGTCCCGCGACCCCTGTTGCCCCTGTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTCAAGCAACTTTTCGCTGCAATCTCCACAGCTCTCGCCATCACTGGTGCAAACGCTGCCCTTACTAGGCGTGTAGCTTGCCCCGATGGTGTTAACACCGCCACGAACGCAGCC
TGCTGCAACCTCTTCACTGTTCGAGATGACTTGCAGAAGAACCTCTTCAACGGGGCTCAATGCAATGACGAGGCTCACGAAGCTTTCCGTCTCACGTTCCACGATGCTATCGCCTTCTCT
CCGGCCCTTCAGGCCCAGGGTCAATTCGG
TGGTGGAGGCGCTGATGGCTCCATCGTCATCTTCTCTGAAATTGAGACTCAGTTCCACGCCAACATCGGTCTGGACGAGGTAATTGCGATC
CAGAAGCCCTTCTTGGAGAGAAGCAACATGAGCGTTGCGGACTT
CATCCAATTTGCCGGTGCTGTCGGCATATCCAACTGTCCCGGTGCGCCTCAGCTGAACGCCTTTGTCGGACGAACG
GATG
CCACCCAGCCGGCTCCGGATGGCCTCGTCCCCGAGCCGTTTGACACCGTCGACACGATCTTGGCCCGCTTCAACGACGCTGGTGGATTCGATGAGCTCGAGACTGTCTGGTTCTTG
ATCGC
CCACACCGTCGCCGCTCAGAACGACATTGATCCGACCATCCCGCGCACGCCCTTCGACTCCACCCCCGAGCTCTTCGACGGTCAGTTCTTCATCGAGACTCAGCTGCGCGGCACC
CTCTTCCCCGGCGAGGGCGGTATCCAAGGCACCGTCGAGTCTCCCATGAAGGGCGAGTTCCGTCTCCAGTCTGATCACGAC
CTCGCTCGTGACTCCAGGACCGCTTGCGAGTGGCAGTCC
TTCGGCA
CCGACCAGGCTAAGCTTCAGAACCGCTTCCAATTCATCTTCGAGGCTATGGGTCAGCTTGGTACCAACCCCGACGACCTCATCGACTGCAGCGAGGTCCTCCCTGTCCCCCCT
CAACTCACGACCACCCCGCACTTCCCCGCTGGCAAGACCAATGCTGATGTTGAGCAGGCC
TGCGCCGAGACTCCGTTCCCCACTCTCCCCTCCCTCCCTGGTCCCGCGACCCCTGTTGCC
CCTGTGTAA

Retrieve as FASTA