Entry information : PbreLiP05 (LiP5)
Entry ID 9702
Creation 2011-11-01 (Christophe Dunand)
Last sequence changes 2016-06-07 (Catherine Mathe)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-06-07 (Catherine Mathe)
Peroxidase information: PbreLiP05 (LiP5)
Name (synonym) PbreLiP05 (LiP5)
Class Lignin peroxidase    [Orthogroup: LiP005]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phlebia
Organism Phlebia brevispora    [TaxId: 194682 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PbreLiP05
start..stop
S start..stop
PbreLiP01 589 0 16..359 23..363
PrLiP04 501 1e-179 23..359 22..358
PrLiP03 483 1e-172 26..359 25..358
PbreLiP03 468 2e-166 28..359 29..362
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2046..2305 260 N° 2 2356..2490 135 N° 3 2541..2608 68 N° 4 2666..2677 12
N° 5 2726..2767 42 N° 6 2818..2896 79 N° 7 2948..3073 126 N° 8 3127..3196 70
N° 9 3255..3300 46 N° 10 3365..3537 173 N° 11 3595..3663 69  
join(2046..2305,2356..2490,2541..2608,2666..2677,2726..2767,2818..2896,2948..307 3,3127..3196,3255..3300,3365..3537,3595..3663)


exon

Literature and cross-references PbreLiP05 (LiP5)
DNA ref. JGI genome:   scaffold_34 (2046..3663)
Protein sequence: PbreLiP05 (LiP5)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   360 (334)
PWM (Da):   %s   38425.08 (35610.5)  
PI (pH):   %s   4.28 (4.08) Peptide Signal:   %s   cut: 26 range:26-359
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSHICRLRVLTLVLPAGVVKRNTAATCANGETVVNAECCALFRVREDLQNNLFRNECGDEAHEAIRLTFHDAIAFSPALEAEGKFGGGGADGSIAIFPQVETNFQANVGLDEVVEGQRVFLERSGMGVADFIQFAGAVALTNCPGAPVMNASIGRVDATRPAPDGLVPEPFDDVDKILNRFADAGDFDELETVWFLIAHSVASQKDIDPSIPRTPFDSTPAIMDGQFFIETQLKGLGFPGDGPNDGEVLSPLAGEFRLQSDFLLARDNRTACEWQSFGTDQAKLQNRFQFIFQAMGQLGQNVSNLIDCSDVLAIPPPLTTTPHLPAGKTLKDVQPACADTPFPSLTADPGPATRVATV*

Retrieve as FASTA  
Remarks Complete sequence from genomic (10 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTCACATATCTGCCGTCTACGAGTTCTAACGCTCGTCCTACCAGCCGGCGTCGTTAAGCGTAACACAGCTGCAACATGCGCTAATGGCGAAACCGTCGTGAACGCTGAGTGTTGT
GCTCTCTTCCGCGTTCGTGAGGACCTCCAGAACAACCTCTTTCGCAATGAATGTGGCGATGAGGCCCACGAGGCGATCCGTTTGACATTCCACGATGCTATTGCCTTCTCTCCTGCTCTC
GAAGCTGAGGGCAAATTTGG
GTTGGTTCCTCCAATTTCTCACTGAGTATTTTATTAATGGACAATGACAGTGGCGGCGGTGCTGATGGCTCGATCGCTATCTTTCCCCAAGTCGAGACCA
ATTTTCAGGCGAATGTCGGTCTCGACGAGGTCGTCGAAGGGCAGCGTGTATTCCTGGAGAGGAGTGGTATGGGTGTCGCCGACTT
GTATGTACGAGTCATGGCTAGCATCGTGCCGTCTA
ACTTTTTCTTCGTAGTATTCAGTTTGCTGGTGCGGTTGCTCTGACCAACTGCCCCGGTGCTCCTGTCATGAACGCGTCCATCGGTGAGCCCTCTAATAATCTAGAACAACGGCGATACGA
CTAACATACGATTCGTTCAGGACGCGTGGATGGTATGTGGTCTTCGAAATGTGTTTGCATTGTTCAACCATCGTTTTTAGCTACCCGTCCGGCTCCCGATGGACTGGTCCCTGAGCCGTT
CG
GTAAGAGATACCATATGACCCTCTCGGTGCTGTCATTAACGGTGGTGCAGACGACGTTGACAAGATCCTTAATCGCTTCGCCGATGCAGGAGACTTCGATGAGCTTGAGACTGTCTGG
TTCCTGATCGC
GTCAGCATTAGCATTTAGTTTGCACCCGTTAATAGCTGACTTCCTCAACAGCCACTCCGTCGCTTCTCAGAAAGACATTGACCCGTCTATCCCACGCACCCCGTTCGAC
TCAACTCCGGCGATTATGGACGGCCAATTCTTCATCGAGACCCAACTGAAAGGTCTTGGCTTCCCGGG
GTACGTTATATATGCGGCCCTGGTGTAACGATCCACCAATCAGAATCCAACA
GTGACGGCCCTAACGACGGAGAGGTTCTCTCTCCGCTGGCGGGAGAGTTCCGCCTGCAGTCTGACTTCTTGGTATGTAATCACATCTATGTCACAAAGAGGCGGCGATAACCATACGCAT
GCCGGCCAGCTTGCGCGCGACAACAGGACCGCCTGTGAATGGCAATCTTTTGGAAGTGAGTAATATCCCGGATGTTTGCTGTCGTCTTGAACTGAAACTCAACCACAACATGTCTGCAGC
GGACCAGGCCAAGCTTCAGAACCGCTTCCAGTTCATTTTCCAGGCAATGGGTCAGCTCGGTCAGAACGTCTCCAATTTGATCGATTGCAGCGACGTCCTGGCCATCCCGCCGCCTTTGAC
CACTACCCCTCACCTCCCGGCGGGGAAGACCCTGAAAGATGTCCAGCCCGCT
GTGCGTATTTTCTTGTTTAATCCTCGTGGTGCCAGCAGTTCAATGACATTGTCCCAGTGCGCTGATAC
CCCCTTCCCTTCTCTCACTGCGGATCCCGGCCCCGCCACCAGGGTTGCTACCGTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTCACATATCTGCCGTCTACGAGTTCTAACGCTCGTCCTACCAGCCGGCGTCGTTAAGCGTAACACAGCTGCAACATGCGCTAATGGCGAAACCGTCGTGAACGCTGAGTGTTGT
GCTCTCTTCCGCGTTCGTGAGGACCTCCAGAACAACCTCTTTCGCAATGAATGTGGCGATGAGGCCCACGAGGCGATCCGTTTGACATTCCACGATGCTATTGCCTTCTCTCCTGCTCTC
GAAGCTGAGGGCAAATTTGG
TGGCGGCGGTGCTGATGGCTCGATCGCTATCTTTCCCCAAGTCGAGACCAATTTTCAGGCGAATGTCGGTCTCGACGAGGTCGTCGAAGGGCAGCGTGTA
TTCCTGGAGAGGAGTGGTATGGGTGTCGCCGACTT
TATTCAGTTTGCTGGTGCGGTTGCTCTGACCAACTGCCCCGGTGCTCCTGTCATGAACGCGTCCATCGGACGCGTGGATGCTACC
CGTCCGGCTCCCGATGGACTGGTCCCTGAGCCGTTCG
ACGACGTTGACAAGATCCTTAATCGCTTCGCCGATGCAGGAGACTTCGATGAGCTTGAGACTGTCTGGTTCCTGATCGCCCAC
TCCGTCGCTTCTCAGAAAGACATTGACCCGTCTATCCCACGCACCCCGTTCGACTCAACTCCGGCGATTATGGACGGCCAATTCTTCATCGAGACCCAACTGAAAGGTCTTGGCTTCCCG
GG
TGACGGCCCTAACGACGGAGAGGTTCTCTCTCCGCTGGCGGGAGAGTTCCGCCTGCAGTCTGACTTCTTGCTTGCGCGCGACAACAGGACCGCCTGTGAATGGCAATCTTTTGGAACG
GACCAGGCCAAGCTTCAGAACCGCTTCCAGTTCATTTTCCAGGCAATGGGTCAGCTCGGTCAGAACGTCTCCAATTTGATCGATTGCAGCGACGTCCTGGCCATCCCGCCGCCTTTGACC
ACTACCCCTCACCTCCCGGCGGGGAAGACCCTGAAAGATGTCCAGCCCGCT
TGCGCTGATACCCCCTTCCCTTCTCTCACTGCGGATCCCGGCCCCGCCACCAGGGTTGCTACCGTGTAA

Retrieve as FASTA