Entry information : SbKat02 (Sobic.001G517700.1 [2.1] / Sb01g048280 [1.4])
Entry ID 971
Creation 2008-10-23 (Christophe Dunand)
Last sequence changes 2011-01-18 (Toky Ramarohetra (Scipio))
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-06 (Messaoudi)
Peroxidase information: SbKat02 (Sobic.001G517700.1 [2.1] / Sb01g048280 [1.4])
Name (synonym) SbKat02 (Sobic.001G517700.1 [2.1] / Sb01g048280 [1.4])
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue types Roots
Seedlings
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SbKat02
start..stop
S start..stop
OsKat03 961 0 1..492 1..492
ZmKat2 954 0 1..492 1..493
GhKat02 912 0 1..492 1..492
ZaKat01 910 0 1..492 1..492
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 71302333..71302347 15 N° 2 71302440..71302536 97 N° 3 71303449..71304593 1145 N° 4 71304714..71304781 68
N° 5 71304877..71304970 94 N° 6 71305061..71305120 60  
join(71302333..71302347,71302440..71302536,71303449..71304593,71304714..71304781 ,71304877..71304970,71305061..71305120)


exon

Literature and cross-references SbKat02 (Sobic.001G517700.1 [2.1] / Sb01g048280 [1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 12:   chromosome_1 (71302333..71305120)
Cluster/Prediction ref. UniGene:   Sbi.17797
Protein sequence: SbKat02 (Sobic.001G517700.1 [2.1] / Sb01g048280 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   492
PWM (Da):   %s   56469.14  
PI (pH):   %s   7.3
Sequence 533
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPYKHRPSSTFNAPYWTTNSGAPVWNNDNSLTVGARGPILLEDYHLVEKLANFDRERIPERVVHARGASAKGFFEVTHDITHLSCADFLRAPGVQTPVIVRFSTVIHERGSPETLRDPRGFAVKFYTREGNWDLVGNNFPVFFIRDGMKFPDMVHSLKPNPKTHIQENWRILDFFSHHPESLHMFTFLFDDVGIPADYRHMDGSGVHTYTLINRAGKATYVKFHWRPTCGVRSLLDDEAVAVGGANHSHATKDLTDAIAAGNFPEWTLYIQTMDPEHEDRFDFDPLDVTKTWPEDVFPLQPVGRMVLNRNIDNFFAENEQLAFCPGLIVPGIYYSDDKLLQTRIFSYSDTQRHRLGPNYLLLPANAPKCAHHNNHYDGFMNFMHRDEEVDYFPSRYDPAKNAPRYPIPAVHITGRRDKTVIAKENNFKQPGERYRAMDPARQERFIKRWVDALSDPRLTHEIRSIWLSNWSQADRSLGQKLASRLSAKPSM

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 5 introns) and 50 ESTs (unigene is a compile of kat01 and 02)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGATCCGTACAAGGTACGCCGTGCTCCCCACAGTCCAGAGCCGCACCGCACCGGCTAGCTGCTTATGTTCTTCGTTCATGACTTGATGTGTTGCGTTGCGTGCAGCACCGGCCGTCGAG
CACCTTCAACGCCCCGTACTGGACCACCAACTCCGGCGCGCCCGTATGGAACAACGACAACTCCCTCACCGTCGGCGCACGAG
GTAACTGCTGCTGCTGCTGTCTGTTCGTACCGCCGGC
TAGAGCTACCTAGCGATGCCGCCGTACGTCGCTCTAGCAGGGGTACCTGATGAGTGCTGCGCTAGTAGTGGAATTCAGGTAGCTAGTACAGTAATACGTTGCGGTTGGTTACGTACTTAC
ATGGCGGTGATACTACTAAACGCCTTCGATCGAATAAACTGTGTAGGTAGCTAGCTACGTACGGGAAGTTTCGTTGTGAGTTTAGTAGGAGTCAGCTACGAGGAATGATCAGCAACATGA
CGAAGCTGCTGCAGAGAGCAGAGCACGTACGCACGGTACCACTAGAAGAATTTCGAAGTAACACCTTTAACTAATACTACAGTACTAGGAGTACTTCATTAATTGAACTCCAAGTATTAT
CTGGTTACTCCTATGATAATTGATAAGGACAGACAGTAAAAAAAATCTCAACTTAGCTCTATTATTACCCCTCGTAAATATAGATTAATGATGAAATTCACAAAATATATCTAAAAAATA
AAGTTCTCAGTCCACCCTACCTTATAAATTTATGTCTAAAATTAGAAAAAGAGCACTAAGAATTCCACTGGGCCAGCAGCGGTAGAGGGGGCAGCAGCCCCTCTAGCCCCACTGTTGGCT
TCGTCGCTGACTGTACCTCCAATTCTAGAGTTCAGGAAATCAGGAGTACTATGTCAGCTTAGTCCTGGTTTACTTTACCACTAGTACTTGTGATGTTTAGAATCAAATCATCAAGCAGTC
GGAAGTAGCGCACTCCTGAGTCCTGACCTCTCGTGGTCTCGTACGTGTAATTTGACGGTAATGGCAACTGAGCTGAGCTGAACAAGAACACAGTTGAAGAAGCGCTGTAGGATTAATTAG
TTAATTAATCATTATATTTGTTCGTCATGGATCAGGTCCCATCCTGCTTGAGGACTACCACCTGGTGGAGAAGCTTGCCAACTTCGACCGTGAGCGGATCCCGGAGCGCGTGGTGCACGC
CCGTGGCGCCAGCGCCAAGGGCTTCTTCGAGGTGACCCACGACATCACCCACCTGTCGTGCGCCGACTTCCTGCGCGCCCCCGGCGTGCAGACCCCCGTGATCGTGCGCTTCTCCACGGT
GATCCACGAGCGCGGGAGCCCCGAGACGCTGCGCGACCCGCGCGGGTTCGCCGTCAAGTTCTACACCCGGGAGGGCAACTGGGACCTGGTGGGCAACAACTTCCCCGTCTTCTTCATCCG
CGACGGCATGAAGTTCCCGGACATGGTGCACTCGCTCAAACCAAACCCCAAGACGCACATCCAGGAGAACTGGCGCATCCTCGACTTCTTCTCCCACCACCCGGAGAGCCTCCACATGTT
CACCTTCCTCTTCGACGACGTCGGCATCCCCGCCGACTACCGCCACATGGACGGCTCCGGGGTGCACACCTACACGCTCATCAACCGCGCCGGCAAGGCCACCTACGTCAAGTTCCACTG
GCGCCCCACCTGCGGCGTCAGGTCGCTGCTGGACGACGAGGCCGTCGCCGTCGGCGGCGCCAACCACAGCCACGCCACCAAGGACCTCACCGACGCCATCGCGGCGGGGAACTTCCCGGA
GTGGACGCTCTACATCCAGACCATGGACCCTGAGCACGAGGACCGCTTCGACTTCGACCCGCTGGACGTGACCAAGACGTGGCCCGAGGACGTGTTCCCGCTGCAGCCCGTGGGGCGGAT
GGTGCTCAACCGCAACATCGACAACTTCTTCGCCGAGAACGAGCAGCTGGCATTCTGCCCGGGACTCATCGTCCCTGGGATCTACTACTCCGACGACAAGCTGCTGCAGACCAGGATCTT
CTCCTACTCCGACACGCAGCGCCACCGCCTGGGACCAAACTACCTGCTACTCCCGGCCAACGCGCCCAAGTGCGCACACCACAACAACCATTACGACGGCTTCATGAACTTCATGCACCG
CGACGAGGAGGTGGACTACTTCCCCTCCAGGTACGACCCTGCCAAGAACGCGCCGAGGTACCCAATCCCGGCCGTCCACATCACCGGCCGCCGAGACAAG
GTACCCAATCCTCAGTGATC
ATCATTTCATTTTTACTCTAATGTAGAATGTAGTAATGTCTACTCGATCCATCACTGACTGAGTCTGAATGATCGATCACCTGTTGGTTTGTTGGTGCAGACTGTGATTGCCAAGGAGAA
CAACTTCAAGCAGCCTGGGGAGAGGTACCGCGCAATGGACCCAGCCAG
GTATGGCATTCCATTCATCAAATGCTCTCTTACTGATCACTGAACTGCATGTTTGCTTACTGAGCTGAACCG
GACTGTGCTCATCATATCTGCAGGCAAGAGCGATTCATCAAGAGATGGGTCGATGCACTCTCTGACCCCCGACTCACCCATGAGATCAGGAGCATCTGGCTCTCCAACTGGTCTCAGGTA
ATGTAACTGCAGCTTATTCAGACAATGAGTTGCTTGCTGAACTGAATGAGTTTTCTGAATCGCTGGTTGCCTGATCAATGGATGCAGGCCGACAGATCTCTGGGCCAGAAGCTTGCGAGC
CGCCTCAGCGCCAAGCCGAGCATGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGATCCGTACAAGCACCGGCCGTCGAGCACCTTCAACGCCCCGTACTGGACCACCAACTCCGGCGCGCCCGTATGGAACAACGACAACTCCCTCACCGTCGGCGCACGAGGTCCCATCC
TGCTTGAGGACTACCACCTGGTGGAGAAGCTTGCCAACTTCGACCGTGAGCGGATCCCGGAGCGCGTGGTGCACGCCCGTGGCGCCAGCGCCAAGGGCTTCTTCGAGGTGACCCACGACA
TCACCCACCTGTCGTGCGCCGACTTCCTGCGCGCCCCCGGCGTGCAGACCCCCGTGATCGTGCGCTTCTCCACGGTGATCCACGAGCGCGGGAGCCCCGAGACGCTGCGCGACCCGCGCG
GGTTCGCCGTCAAGTTCTACACCCGGGAGGGCAACTGGGACCTGGTGGGCAACAACTTCCCCGTCTTCTTCATCCGCGACGGCATGAAGTTCCCGGACATGGTGCACTCGCTCAAACCAA
ACCCCAAGACGCACATCCAGGAGAACTGGCGCATCCTCGACTTCTTCTCCCACCACCCGGAGAGCCTCCACATGTTCACCTTCCTCTTCGACGACGTCGGCATCCCCGCCGACTACCGCC
ACATGGACGGCTCCGGGGTGCACACCTACACGCTCATCAACCGCGCCGGCAAGGCCACCTACGTCAAGTTCCACTGGCGCCCCACCTGCGGCGTCAGGTCGCTGCTGGACGACGAGGCCG
TCGCCGTCGGCGGCGCCAACCACAGCCACGCCACCAAGGACCTCACCGACGCCATCGCGGCGGGGAACTTCCCGGAGTGGACGCTCTACATCCAGACCATGGACCCTGAGCACGAGGACC
GCTTCGACTTCGACCCGCTGGACGTGACCAAGACGTGGCCCGAGGACGTGTTCCCGCTGCAGCCCGTGGGGCGGATGGTGCTCAACCGCAACATCGACAACTTCTTCGCCGAGAACGAGC
AGCTGGCATTCTGCCCGGGACTCATCGTCCCTGGGATCTACTACTCCGACGACAAGCTGCTGCAGACCAGGATCTTCTCCTACTCCGACACGCAGCGCCACCGCCTGGGACCAAACTACC
TGCTACTCCCGGCCAACGCGCCCAAGTGCGCACACCACAACAACCATTACGACGGCTTCATGAACTTCATGCACCGCGACGAGGAGGTGGACTACTTCCCCTCCAGGTACGACCCTGCCA
AGAACGCGCCGAGGTACCCAATCCCGGCCGTCCACATCACCGGCCGCCGAGACAAG
ACTGTGATTGCCAAGGAGAACAACTTCAAGCAGCCTGGGGAGAGGTACCGCGCAATGGACCCAG
CCAG
GCAAGAGCGATTCATCAAGAGATGGGTCGATGCACTCTCTGACCCCCGACTCACCCATGAGATCAGGAGCATCTGGCTCTCCAACTGGTCTCAGGCCGACAGATCTCTGGGCCAGA
AGCTTGCGAGCCGCCTCAGCGCCAAGCCGAGCATGTAA

Retrieve as FASTA