Entry information : BaLiP01
Entry ID 9721
Creation 2011-11-17 (Christophe Dunand)
Last sequence changes 2011-11-17 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-01 (Catherine Mathe)
Peroxidase information: BaLiP01
Name BaLiP01
Class Lignin peroxidase    [Orthogroup: LiP003]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Meruliaceae Bjerkandera
Organism Bjerkandera adusta    [TaxId: 5331 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BaLiP01
start..stop
S start..stop
BaLiP04 562 0 1..369 1..362
BaLiP09 559 0 1..369 1..364
BaLiP03 557 0 1..369 1..362
BaLiP12 555 0 1..369 1..362
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 153397..153457 61 N° 2 153194..153344 151 N° 3 153085..153141 57 N° 4 152896..153030 135
N° 5 152769..152836 68 N° 6 152661..152714 54 N° 7 152527..152605 79 N° 8 152348..152473 126
N° 9 151984..152293 310 N° 10 151860..151928 69  
complement(join(151860..151928,151984..152293,152348..152473,152527..152605,1526 61..152714,152769..152836,152896..153030,153085..153141,153194..153344,153397..1 53457))


exon

Literature and cross-references BaLiP01
DNA ref. JGI genome:   scaffold_37 (153457..151860)
Protein sequence: BaLiP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   369 (348)
PWM (Da):   %s   38841.97 (36710.8)  
PI (pH):   %s   4.08 (4.04) Peptide Signal:   %s   cut: 22 range:22-369
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKQLLAALSVAIFLGTAQGAITRRVACPDGVNTATNAACCALFAVRDDIQANMFDGGQCNDVAHQSLRLTFHDAVAFSPALTAQGQFGGNGADGSIITFGDIETAFHPNIGLDEIVAIQKPFIAKHNMTAGDFLHFAGAIATTNCPGAPTISFLGRPEATQAAPDGLVPEPFHTVDQILARMNDALEFDELETVWALIAHTTGAANDIDTTIPRTPFDSTPTLFDSQFFIETQLKGTLFPGTGGDNGANTGEVMSALAGEMRLQSDFLIARDARTACEWQSFSGNMPKLQNRFQFVLETFAVVGQDQTNMIDCSEVIPVPVDLTDEQAAGFFPPGKTLDDVEGCADTPFPSFATAPGPATAIPAV*

Retrieve as FASTA  
Remarks Complete sequence from genomic (9 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAGCAACTCCTCGCTGCGCTCTCCGTCGCAATTTTCCTAGGCACCGCCCAGGGTATGCTCTCTACGCCGTACCTCCGACCGCCACCGTGCTGATTGCTTTTCAGGTGCGAT
TACCAGGCGTGTTGCCTGCCCCGACGGGGTGAACACTGCGACGAACGCCGCATGCTGCGCCTTGTTCGCCGTTCGCGACGACATCCAGGCCAACATGTTCGACGGCGGCCAGTGCAACGA
CGTTGCCCACCAGTCGCTCCGTTT
GTGAGTGCAACGGCCGACGAGCTGCATTCGCCATACTCATACATCGACTCAGGACTTTCCACGATGCGGTCGCGTTCTCTCCCGCGCTCACTGCTC
AGGGCCAGTTCGG
GTAAGTTTTCCTCCCTGCCACACAAAGCGTCTGCTGATTAGACTTATCATCTAGAGGAAACGGTGCTGACGGTTCTATCATCACCTTCGGTGATATCGAGACGGCCT
TCCACCCCAACATCGGCCTCGACGAAATCGTCGCCATCCAGAAGCCCTTCATCGCGAAGCACAACATGACAGCTGGCGACTT
GTAAGTCTCCTGCAGATAGCCTATCATATCTTCAACTC
AGTCATTACTTCGGCGATTAGCCTCCACTTCGCTGGTGCGATTGCTACGACCAACTGCCCAGGCGCTCCCACCATCAGCTTCCTCTTGGGTAAATTATCCCCATTACTATCTTATTATTA
TTCAACTAATTATTGCATCTCAGGCCGTCCCGAGGCTACTCAGGCTGCTCCTGATGGTCTCGTCCCTGAGCCGTTCCGTACGTCTCGCCATTCTTTACAGCTGAACTTCGCTGACGTCGG
CACCAAAACCAGACACTGTCGACCAGATTCTGGCCCGCATGAACGACGCGCTGGAGTTTGACGAGCTCGAAACCGTTTGGGCTCTCATTGCGTGAGTATAAGTTTCATCAGTACAATGCT
GCTGTTGACTGACCTCCAAATCAGCCACACCACTGGTGCCGCCAACGATATCGACACAACCATCCCGCGCACCCCCTTCGACTCTACGCCGACGCTCTTCGACTCCCAGTTCTTCATCGA
GACCCAGCTCAAGGGCACCTTATTCCCTGG
GTAAGCGGGAGCTACTACGTTACAACACGCGTATCGAACTGACATGCGCATTAGCACTGGTGGAGACAACGGCGCAAACACGGGCGAAGT
CATGTCTGCTCTGGCCGGCGAGATGCGTCTGCAGTCCGACTTCCTCATCGCCCGCGACGCGAGGACAGCCTGCGAGTGGCAATCGTTCTCTGGTAACATGCCCAAGCTCCAGAACCGATT
CCAGTTCGTCCTCGAGACCTTTGCCGTCGTTGGCCAGGACCAGACCAACATGATCGACTGCTCCGAGGTCATCCCCGTCCCCGTTGATCTCACCGACGAGCAGGCTGCTGGCTTCTTCCC
TCCCGGAAAGACCCTCGATGATGTCGAGGGAGCT
GTGAGTTATCTTTCGTCCTTTCTCGTGTGCCTCAGACTGATTGCACGTCGTTCAGTGCGCCGACACTCCGTTCCCCTCGTTCGCTA
CCGCCCCTGGCCCCGCCACTGCTATCCCCGCCGTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAGCAACTCCTCGCTGCGCTCTCCGTCGCAATTTTCCTAGGCACCGCCCAGGGTGCGATTACCAGGCGTGTTGCCTGCCCCGACGGGGTGAACACTGCGACGAACGCCGCA
TGCTGCGCCTTGTTCGCCGTTCGCGACGACATCCAGGCCAACATGTTCGACGGCGGCCAGTGCAACGACGTTGCCCACCAGTCGCTCCGTTT
GACTTTCCACGATGCGGTCGCGTTCTCT
CCCGCGCTCACTGCTCAGGGCCAGTTCGG
AGGAAACGGTGCTGACGGTTCTATCATCACCTTCGGTGATATCGAGACGGCCTTCCACCCCAACATCGGCCTCGACGAAATCGTCGCCATC
CAGAAGCCCTTCATCGCGAAGCACAACATGACAGCTGGCGACTT
CCTCCACTTCGCTGGTGCGATTGCTACGACCAACTGCCCAGGCGCTCCCACCATCAGCTTCCTCTTGGGCCGTCCC
GAGGCTACTCAGGCTGCTCCTGATGGTCTCGTCCCTGAGCCGTTCC
ACACTGTCGACCAGATTCTGGCCCGCATGAACGACGCGCTGGAGTTTGACGAGCTCGAAACCGTTTGGGCTCTC
ATTGC
CCACACCACTGGTGCCGCCAACGATATCGACACAACCATCCCGCGCACCCCCTTCGACTCTACGCCGACGCTCTTCGACTCCCAGTTCTTCATCGAGACCCAGCTCAAGGGCACC
TTATTCCCTGG
CACTGGTGGAGACAACGGCGCAAACACGGGCGAAGTCATGTCTGCTCTGGCCGGCGAGATGCGTCTGCAGTCCGACTTCCTCATCGCCCGCGACGCGAGGACAGCCTGC
GAGTGGCAATCGTTCTCTGGTAACATGCCCAAGCTCCAGAACCGATTCCAGTTCGTCCTCGAGACCTTTGCCGTCGTTGGCCAGGACCAGACCAACATGATCGACTGCTCCGAGGTCATC
CCCGTCCCCGTTGATCTCACCGACGAGCAGGCTGCTGGCTTCTTCCCTCCCGGAAAGACCCTCGATGATGTCGAGGGAGCT
TGCGCCGACACTCCGTTCCCCTCGTTCGCTACCGCCCCT
GGCCCCGCCACTGCTATCCCCGCCGTGTAA

Retrieve as FASTA