Entry information : BaCIIBB02
Entry ID 9724
Creation 2011-11-17 (Christophe Dunand)
Last sequence changes 2012-12-04 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-12-04 (Christophe Dunand)
Peroxidase information: BaCIIBB02
Name BaCIIBB02
Class Other class II peroxidase type B    [Orthogroup: CIIBB001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Meruliaceae Bjerkandera
Organism Bjerkandera adusta    [TaxId: 5331 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BaCIIBB02
start..stop
S start..stop
BaCIIBB06 588 0 1..366 1..366
BaCIIBB08 541 0 1..366 1..366
TvCIIBB02_IFO30340 538 0 1..366 1..365
PbreCIIBB09 536 0 1..366 1..365
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 446806..446866 61 N° 2 446919..447069 151 N° 3 447124..447180 57 N° 4 447234..447368 135
N° 5 447419..447486 68 N° 6 447538..447670 133 N° 7 447727..447852 126 N° 8 447909..448024 116
N° 9 448080..448255 176 N° 10 448314..448378 65 N° 11 448440..448452 13  
join(446806..446866,446919..447069,447124..447180,447234..447368,447419..447486, 447538..447670,447727..447852,447909..448024,448080..448255,448314..448378,44844 0..448452)


exon

Literature and cross-references BaCIIBB02
DNA ref. JGI genome:   scaffold_24 (446806..448382)
Protein sequence: BaCIIBB02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   366 (345)
PWM (Da):   %s   38154.79 (35962.6)  
PI (pH):   %s   4.16 (4.14) Peptide Signal:   %s   cut: 22 range:22-366
Sequence 407
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKQLLATVSLAFSLTAVEAALTRRVACPDGVNTATNAACCSLFAIRDDLQKNLFDNGGCGEDVHESLRLTFHDAIGISPAIAATGKFGGGGADGSIAIFEDIETNFHANLGVDEIIDEQKPILARHNISTADFIQFAGAVGLSNCPGAPQVEFLFGRTDATQPAPDLTVPEPSDTVDSILARFDDAGGFTAAEIIALLASHTIAAADHVDPTIPGTPFDSTASTFDSQFFVETLLKGTLFPGTSGNVGEVMSPIAGEMRLQSDFEFAQDSRTACEWQSFVNNQDKIKTAFAAAFAKMTTLGNDRSQMVDCSEVLPRVSTATLPPAHLPAGKTLADVQQACADTPFPSLSADPGPATTVPPVPPS

Retrieve as FASTA  
Remarks Complete sequence from genomic (10 introns). incorrect prediction from JGI (last very short exon is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCCTTCAAGCAGCTCCTTGCTACTGTCTCTCTCGCCTTCTCCCTCACCGCCGTCGAAGGTTTGTAAGGAGTCACTCTGCCCACCACTTGTACTCATCTACCGTGCTTTAGCCGCCCTG
ACCCGCCGGGTTGCTTGTCCCGATGGCGTGAACACCGCGACGAACGCGGCTTGCTGTTCTCTGTTCGCCATCCGCGACGATCTTCAGAAGAACCTGTTCGACAACGGCGGTTGTGGCGAA
GATGTTCACGAGTCTCTCCGTCT
GTGAGTATACGACCAACCCCGAATTCCGACCTAAAAATTGACCGGATATACTAGCACCTTCCACGACGCTATCGGTATTTCTCCCGCCATCGCAGCA
ACCGGAAAATTCGG
GTGCGTATACACCCGAAATGTGATTTCTCTCCGCTTTCTGACTAGTCACGCAGAGGTGGAGGTGCCGATGGCTCTATTGCCATCTTCGAGGACATCGAGACCAACT
TCCACGCTAACTTGGGCGTTGACGAGATCATCGACGAGCAGAAGCCCATCCTGGCTAGACACAACATCTCTACCGCGGACTT
GTTCGTCGCTCCCTGTTCATTCTCCATTACGCTGCTGA
TCGATTGTTTAGCATCCAGTTTGCTGGCGCAGTCGGTTTGAGCAACTGCCCCGGCGCTCCTCAGGTCGAGTTCCTCTTCGGTAAGCGAAACCGTCTTTCCTCATAACGCATCAACTCACG
CGACTGTACAGGCCGCACAGACGCCACCCAGCCTGCTCCCGACCTGACCGTCCCCGAGCCTTCCGACACCGTCGACTCCATCCTCGCTCGCTTCGATGACGCCGGAGGCTTCACCGCCGC
GGAGATCATTGCCCTTCTCGCCTC
GTAAGGTCATCTACCACTGCCAAAGGGATCTAAGCTGATCCACGCCACCTATGCAGCCACACCATCGCCGCGGCCGACCACGTCGACCCCACCATC
CCGGGAACTCCGTTCGACTCGACTGCCTCCACCTTCGACTCTCAGTTCTTCGTCGAGACGCTACTCAAGGGCACGCTCTTCCCCGG
GTAAGCCTACCTTCGACCCCACCTCTCGCGTCCA
TCTTTGACACTAAGCACCACAGAACTTCGGGCAACGTCGGAGAGGTGATGTCCCCCATCGCGGGTGAGATGCGTCTGCAGTCCGACTTCGAGTTCGCACAAGACTCTCGTACTGCTTGCG
AGTGGCAGTCTTTCGTCA
GTGCGTACCCTCTCCTTGCCTTTCGCTCCGCCCGGATATTCTGACCGTATACCAGACAACCAGGACAAGATCAAGACCGCGTTTGCTGCCGCGTTCGCCAAG
ATGACCACCCTCGGAAATGACAGGAGCCAGATGGTCGACTGCTCCGAGGTGCTGCCCAGAGTCTCGACTGCCACTCTCCCGCCCGCGCACCTCCCCGCCGGCAAGACGCTCGCCGACGTC
CAACAGGCT
GTACGCACTTCATATTTGCGCTGTGTGCGAGAAATTGAGCTGACGATACCTGCATCAGTGCGCTGACACGCCCTTCCCGTCTCTGTCTGCCGACCCCGGCCCGGCCACCAC
TGTTCCCCCTGT
GTAAGTGTTCTACGATACAACGCCTTTAGCGACGGTGTGCTAACGTGATAAATTCATACAGCCCGCCTTCCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCCTTCAAGCAGCTCCTTGCTACTGTCTCTCTCGCCTTCTCCCTCACCGCCGTCGAAGCCGCCCTGACCCGCCGGGTTGCTTGTCCCGATGGCGTGAACACCGCGACGAACGCGGCTT
GCTGTTCTCTGTTCGCCATCCGCGACGATCTTCAGAAGAACCTGTTCGACAACGGCGGTTGTGGCGAAGATGTTCACGAGTCTCTCCGTCT
CACCTTCCACGACGCTATCGGTATTTCTC
CCGCCATCGCAGCAACCGGAAAATTCGG
AGGTGGAGGTGCCGATGGCTCTATTGCCATCTTCGAGGACATCGAGACCAACTTCCACGCTAACTTGGGCGTTGACGAGATCATCGACGAGC
AGAAGCCCATCCTGGCTAGACACAACATCTCTACCGCGGACTT
CATCCAGTTTGCTGGCGCAGTCGGTTTGAGCAACTGCCCCGGCGCTCCTCAGGTCGAGTTCCTCTTCGGCCGCACAG
ACGCCACCCAGCCTGCTCCCGACCTGACCGTCCCCGAGCCTTCCGACACCGTCGACTCCATCCTCGCTCGCTTCGATGACGCCGGAGGCTTCACCGCCGCGGAGATCATTGCCCTTCTCG
CCTC
CCACACCATCGCCGCGGCCGACCACGTCGACCCCACCATCCCGGGAACTCCGTTCGACTCGACTGCCTCCACCTTCGACTCTCAGTTCTTCGTCGAGACGCTACTCAAGGGCACGC
TCTTCCCCGG
AACTTCGGGCAACGTCGGAGAGGTGATGTCCCCCATCGCGGGTGAGATGCGTCTGCAGTCCGACTTCGAGTTCGCACAAGACTCTCGTACTGCTTGCGAGTGGCAGTCTT
TCGTCA
ACAACCAGGACAAGATCAAGACCGCGTTTGCTGCCGCGTTCGCCAAGATGACCACCCTCGGAAATGACAGGAGCCAGATGGTCGACTGCTCCGAGGTGCTGCCCAGAGTCTCGA
CTGCCACTCTCCCGCCCGCGCACCTCCCCGCCGGCAAGACGCTCGCCGACGTCCAACAGGCT
TGCGCTGACACGCCCTTCCCGTCTCTGTCTGCCGACCCCGGCCCGGCCACCACTGTTC
CCCCTGT
CCCGCCTTCCTAG

Retrieve as FASTA