Entry information : BaLiP03
Entry ID 9725
Creation 2011-11-17 (Christophe Dunand)
Last sequence changes 2012-03-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-02 (Christophe Dunand)
Peroxidase information: BaLiP03
Name BaLiP03
Class Lignin peroxidase    [Orthogroup: LiP003]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Meruliaceae Bjerkandera
Organism Bjerkandera adusta    [TaxId: 5331 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BaLiP03
start..stop
S start..stop
BaLiP03_IFO5307 753 0 1..372 1..372
BaLiP12 702 0 1..362 1..362
BaLiP07 701 0 1..372 1..371
BaLiP05 672 0 1..372 1..372
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 669949..670208 260 N° 2 670271..670485 215 N° 3 670550..671094 545 N° 4 671156..671220 65
N° 5 671279..671312 34  
join(669949..670208,670271..670485,670550..671094,671156..671220,671279..671312)


exon

Literature and cross-references BaLiP03
DNA ref. JGI genome:   scaffold_19 (669949..671312)
Protein sequence: BaLiP03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   372
PWM (Da):   %s   39510.5  
PI (pH):   %s   4.52
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKQLLATLSAALVAQAAITRRVACPDGKNTAINAACCSLFTARDDIQKNMFDGGQCNDVAHQAIRLTFHDAVAFSPTLTAQGKFGGNGADGSIMTFDTIETNFHPNIGLDEIVNIEKPFAQFHNMTPGDFIHFAGAIAVTNCPGAPTLTFAIGRPPVAAAPDGLVPEPFHTADQIFARMLDALQFDELETVWGLIAHTVGASNDVDPSIPRTPFDSTPSIFDGQFFIDTQLRGELFPGQGGLQGEVESPLKGQIRLQSDHIIARDSRSACEWQSFANDHDKLTNRFQFVIETLAMVGQDPTNMIDCSEVIPIPKDLTAAQLTPMFPAGKTNADVEQCADTPFPSFATRPGPATAVPPVPSAKTGAPGS

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns). Uncorrect prediction from JGI (last intrOn is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAGCAGCTCCTCGCCACCCTCTCCGCCGCCCTTGTGGCGCAGGCAGCGATCACCCGCCGTGTTGCCTGCCCCGACGGCAAGAACACCGCGATCAACGCGGCGTGCTGCAGC
CTGTTCACTGCGCGCGACGACATCCAGAAGAACATGTTCGACGGCGGGCAGTGCAATGACGTTGCGCACCAGGCCATCCGCCTGACCTTCCACGACGCCGTCGCGTTCTCGCCGACTCTG
ACGGCGCAGGGCAAGTTCGG
GTGCGTACCAAATATATCCATCTATGTCGAGGATGTAAAAATCATGCTGACGAGGACTGTAGTGGGAACGGCGCCGACGGGTCTATCATGACCTTCGACA
CCATCGAGACCAACTTCCACCCGAACATCGGCCTCGACGAGATCGTCAACATCGAAAAGCCGTTCGCCCAGTTCCACAACATGACCCCCGGTGACTTCATCCACTTTGCGGGTGCCATCG
CCGTGACGAACTGCCCCGGCGCGCCCACGCTCACCTTCGCCATCGGCCGTCCCCCAC
GTACGCCCCTCCCCAAACCCCCCTCCCTTGAATTCATACTGATGACAGTTGCGGGTTTGTTTA
GCGGTCGCTGCTGCCCCCGACGGCCTCGTCCCAGAGCCGTTCCACACCGCAGACCAGATCTTCGCGCGCATGCTCGACGCGCTTCAGTTCGACGAGCTCGAGACCGTGTGGGGGCTGATC
GCGCACACCGTCGGCGCGTCCAACGACGTCGACCCGTCCATCCCGCGCACGCCCTTCGACTCCACCCCCTCGATCTTCGACGGCCAGTTCTTCATCGACACGCAGCTGCGCGGCGAGCTC
TTCCCTGGCCAAGGCGGGCTGCAGGGCGAGGTGGAGTCGCCGCTGAAGGGCCAGATCCGGCTGCAGAGCGACCACATCATCGCGCGCGACTCGCGCTCGGCGTGCGAGTGGCAGTCGTTC
GCGAACGACCACGACAAGCTCACGAACCGCTTCCAGTTCGTCATCGAGACCCTCGCGATGGTCGGACAGGACCCGACGAACATGATTGATTGCTCTGAGGTCATCCCCATCCCCAAGGAC
CTCACCGCCGCGCAACTCACTCCCATGTTCCCCGCTGGAAAGACCAACGCTGATGTCGAGCAGGCT
GTACGTACCCTTTACTTTCGCAATTCTTTTCGGAATAAAACGCTAACGAATGAT
CTTATAGTGCGCCGACACGCCCTTCCCGTCCTTCGCCACCCGCCCGGGCCCCGCCACCGCTGTCCCTCCCGTGTACGTCTCCCCTTCCAGCCTATCGAAATACTTGACCTGACGACGTTC
CTTTCTTTAGCCCCTCTGCCAAGACTGGAGCTCCCGGCTCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAGCAGCTCCTCGCCACCCTCTCCGCCGCCCTTGTGGCGCAGGCAGCGATCACCCGCCGTGTTGCCTGCCCCGACGGCAAGAACACCGCGATCAACGCGGCGTGCTGCAGC
CTGTTCACTGCGCGCGACGACATCCAGAAGAACATGTTCGACGGCGGGCAGTGCAATGACGTTGCGCACCAGGCCATCCGCCTGACCTTCCACGACGCCGTCGCGTTCTCGCCGACTCTG
ACGGCGCAGGGCAAGTTCGG
TGGGAACGGCGCCGACGGGTCTATCATGACCTTCGACACCATCGAGACCAACTTCCACCCGAACATCGGCCTCGACGAGATCGTCAACATCGAAAAGCCG
TTCGCCCAGTTCCACAACATGACCCCCGGTGACTTCATCCACTTTGCGGGTGCCATCGCCGTGACGAACTGCCCCGGCGCGCCCACGCTCACCTTCGCCATCGGCCGTCCCCCAC
CGGTC
GCTGCTGCCCCCGACGGCCTCGTCCCAGAGCCGTTCCACACCGCAGACCAGATCTTCGCGCGCATGCTCGACGCGCTTCAGTTCGACGAGCTCGAGACCGTGTGGGGGCTGATCGCGCAC
ACCGTCGGCGCGTCCAACGACGTCGACCCGTCCATCCCGCGCACGCCCTTCGACTCCACCCCCTCGATCTTCGACGGCCAGTTCTTCATCGACACGCAGCTGCGCGGCGAGCTCTTCCCT
GGCCAAGGCGGGCTGCAGGGCGAGGTGGAGTCGCCGCTGAAGGGCCAGATCCGGCTGCAGAGCGACCACATCATCGCGCGCGACTCGCGCTCGGCGTGCGAGTGGCAGTCGTTCGCGAAC
GACCACGACAAGCTCACGAACCGCTTCCAGTTCGTCATCGAGACCCTCGCGATGGTCGGACAGGACCCGACGAACATGATTGATTGCTCTGAGGTCATCCCCATCCCCAAGGACCTCACC
GCCGCGCAACTCACTCCCATGTTCCCCGCTGGAAAGACCAACGCTGATGTCGAGCAGGCT
TGCGCCGACACGCCCTTCCCGTCCTTCGCCACCCGCCCGGGCCCCGCCACCGCTGTCCCT
CCCGT
CCCCTCTGCCAAGACTGGAGCTCCCGGCTCTTAA

Retrieve as FASTA