Entry information : BaLiP08
Entry ID 9732
Creation 2011-11-17 (Christophe Dunand)
Last sequence changes 2011-11-17 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2012-10-29 (Nizar Fawal)
Peroxidase information: BaLiP08
Name BaLiP08
Class Lignin peroxidase    [Orthogroup: LiP003]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Meruliaceae Bjerkandera
Organism Bjerkandera adusta    [TaxId: 5331 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BaLiP08
start..stop
S start..stop
BaLiP11 697 0 1..373 1..373
BaLiP09 587 0 1..362 1..364
BaLiP04 572 0 1..362 1..362
BaLiP05 552 0 1..364 1..364
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 340946..341157 212 N° 2 341211..341267 57 N° 3 341318..341452 135 N° 4 341503..341570 68
N° 5 341626..341637 12 N° 6 341687..341728 42 N° 7 341784..341862 79 N° 8 341918..342043 126
N° 9 342105..342220 116 N° 10 342279..342451 173 N° 11 342510..342574 65 N° 12 342628..342664 37
join(340946..341157,341211..341267,341318..341452,341503..341570,341626..341637, 341687..341728,341784..341862,341918..342043,342105..342220,342279..342451,34251 0..342574,342628..342664)


exon

Literature and cross-references BaLiP08
DNA ref. JGI genome:   scaffold_19 (340946..342664)
Protein sequence: BaLiP08
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   373 (352)
PWM (Da):   %s   39951.13 (37765.9)  
PI (pH):   %s   6.18 (6.04) Peptide Signal:   %s   cut: 22 range:22-373
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKQLISVLALALSLSITQGAIVKRVTCPGSRNVVANSACCKLFDVRDDIQKNMFEGGKCNDVAHEALRLTFHDAVAISPALEAKGKFGGNGADGSIITFGNIETKFHPNIGLDEIVAIEKPFIAKHNMTPGDFLHFAGAIAVTNCPGAPTISFSGRPPPVRAAPDGLVPEPFHTVDQIFARMNDAMQFDPLETVWALIAHTVAAANDIDTAIPGSPFDSTPSDFDGQFFLETQLKGVVNPGRGNHQGEVLSPLAGEMRLQSDFAIARDSRSACEWQSFNDHDKLTNRFQFVLETFAMLGQDPTHMIDCSEVIPVPAPLRTKPHFPAGKTIHDVERCAETPFPTLLTDGGRATAVASVPKSSVRRAHGF

Retrieve as FASTA  
Remarks Complete sequence from genomic (12 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAGCAGCTCATCTCCGTGCTCGCTCTCGCCCTGTCGCTTTCCATTACCCAGGGCGCCATTGTCAAACGCGTTACGTGCCCCGGCAGTCGCAATGTCGTCGCCAACTCGGCT
TGCTGCAAGTTGTTTGACGTCCGCGACGACATTCAGAAGAACATGTTCGAAGGCGGCAAGTGTAACGATGTCGCTCATGAAGCTCTTCGTCT
GTGAGTTACTTGGTGGTACTCGACCTTT
AGGTTAGACTCAACGCGTTCCCCAGGACGTTCCACGATGCGGTGGCCATTTCACCTGCTCTCGAGGCGAAGGGAAAGTTTGGGTAAGTTTTGATCACTCTATGTTCATGGTTAAATCTTG
ACCCACCTATAGTGGTAACGGCGCCGACGGCTCTATCATCACCTTCGGTAACATCGAGACGAAGTTCCACCCCAACATTGGCCTCGACGAAATTGTCGCCATCGAGAAGCCGTTCATTGC
AAAGCACAATATGACCCCGGGTGACTT
GTACGGACATTTTCTCAGAGCGAAGTATGTGGTGGCTGACAGACACGCAGCCTCCACTTCGCTGGGGCCATAGCAGTGACCAACTGTCCCGGC
GCCCCTACCATCAGCTTTTCTCTAG
GTATGTCATGCTTCCACGCTATCTCAATATTATGTGGCTAATCATGCCGCTGTAGGCCGCCCCCCGCGTCTGTCGTCCACGTTTTTGTCAGCTGC
GCGATCCTGACTTTTGCTTAGCGGTTCGCGCTGCCCCTGATGGTCTTGTTCCTGAGCCATTCCGTGAGTTCATTATATTGCAACCCATTTCGTACCATTCTGATGGACTGTGTTATAGAC
ACCGTCGACCAGATCTTCGCCCGCATGAATGACGCTATGCAATTCGATCCGCTCGAAACTGTATGGGCACTGATCGC
GTAAGCACTTGATGCCTGCGACCCGACAACTTCTTGAGGACTG
ACCGTTCTGTAGGCACACCGTGGCCGCTGCCAACGATATTGATACGGCTATTCCGGGCTCCCCTTTCGACTCAACCCCAAGCGACTTTGATGGCCAGTTCTTCCTGGAGACTCAACTCAA
GGGTGTCGTGAATCCCGG
GTAGGTTGAGCTCCGTGCGACCAATCAAACGTCGGCAGAAGCTGAATGTTCTTTCTCCCAGTCGTGGTAATCACCAGGGCGAAGTTCTCTCCCCACTCGCCG
GCGAGATGCGTCTTCAGTCGGACTTTGCCATCGCCCGCGACTCCCGCAGTGCCTGCGAATGGCAGTCCTTTATAA
GTGAGTTCGATGCCTCCGCTCACGCACGCGAGCCCGCCTTACGGT
TATTTTCTCACAGATGACCACGACAAACTCACCAACCGATTCCAATTTGTCCTCGAGACATTCGCAATGCTCGGCCAAGACCCGACGCACATGATTGACTGTTCAGAGGTCATCCCCGTT
CCGGCTCCCCTCCGTACCAAGCCACACTTTCCCGCTGGAAAGACCATTCACGATGTTGAACGGGCT
GTGCGCTACCCTCTTCCACCTCATTTTGCATTGTTGGTACTAACACTCTCATTT
TCAGTGCGCCGAGACTCCGTTCCCAACCCTCCTGACTGACGGTGGACGCGCGACGGCTGTGGCATCCGTGTACGGCTTCCATGGCGCTCTATTCATGCACAAGCTGAACTACGTCTTTCT
AGCCCGAAGAGCTCCGTGCGCCGCGCTCACGGTTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAGCAGCTCATCTCCGTGCTCGCTCTCGCCCTGTCGCTTTCCATTACCCAGGGCGCCATTGTCAAACGCGTTACGTGCCCCGGCAGTCGCAATGTCGTCGCCAACTCGGCT
TGCTGCAAGTTGTTTGACGTCCGCGACGACATTCAGAAGAACATGTTCGAAGGCGGCAAGTGTAACGATGTCGCTCATGAAGCTCTTCGTCT
GACGTTCCACGATGCGGTGGCCATTTCA
CCTGCTCTCGAGGCGAAGGGAAAGTTTGG
TGGTAACGGCGCCGACGGCTCTATCATCACCTTCGGTAACATCGAGACGAAGTTCCACCCCAACATTGGCCTCGACGAAATTGTCGCCATC
GAGAAGCCGTTCATTGCAAAGCACAATATGACCCCGGGTGACTT
CCTCCACTTCGCTGGGGCCATAGCAGTGACCAACTGTCCCGGCGCCCCTACCATCAGCTTTTCTCTAGGCCGCCCC
CCGC
CGGTTCGCGCTGCCCCTGATGGTCTTGTTCCTGAGCCATTCCACACCGTCGACCAGATCTTCGCCCGCATGAATGACGCTATGCAATTCGATCCGCTCGAAACTGTATGGGCACTG
ATCGC
GCACACCGTGGCCGCTGCCAACGATATTGATACGGCTATTCCGGGCTCCCCTTTCGACTCAACCCCAAGCGACTTTGATGGCCAGTTCTTCCTGGAGACTCAACTCAAGGGTGTC
GTGAATCCCGG
TCGTGGTAATCACCAGGGCGAAGTTCTCTCCCCACTCGCCGGCGAGATGCGTCTTCAGTCGGACTTTGCCATCGCCCGCGACTCCCGCAGTGCCTGCGAATGGCAGTCC
TTTATAA
ATGACCACGACAAACTCACCAACCGATTCCAATTTGTCCTCGAGACATTCGCAATGCTCGGCCAAGACCCGACGCACATGATTGACTGTTCAGAGGTCATCCCCGTTCCGGCT
CCCCTCCGTACCAAGCCACACTTTCCCGCTGGAAAGACCATTCACGATGTTGAACGGGCT
TGCGCCGAGACTCCGTTCCCAACCCTCCTGACTGACGGTGGACGCGCGACGGCTGTGGCA
TCCGT
CCCGAAGAGCTCCGTGCGCCGCGCTCACGGTTTCTGA

Retrieve as FASTA