Entry information : BaLiP12
Entry ID 9740
Creation 2011-11-17 (Christophe Dunand)
Last sequence changes 2011-11-17 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-01 (Catherine Mathe)
Peroxidase information: BaLiP12
Name BaLiP12
Class Lignin peroxidase    [Orthogroup: LiP003]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Meruliaceae Bjerkandera
Organism Bjerkandera adusta    [TaxId: 5331 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BaLiP12
start..stop
S start..stop
BaLiP03 702 0 1..362 1..362
BaLiP03_IFO5307 702 0 1..362 1..362
BaLiP07 669 0 1..362 1..361
BaLiP05 644 0 1..362 1..362
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 80119..80321 203 N° 2 80013..80069 57 N° 3 79746..79960 215 N° 4 79141..79685 545
N° 5 79015..79083 69  
complement(join(79015..79083,79141..79685,79746..79960,80013..80069,80119..80321 ))


exon

Literature and cross-references BaLiP12
DNA ref. JGI genome:   scaffold_19 (80321..79015)
Protein sequence: BaLiP12
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   362 (344)
PWM (Da):   %s   38593.95 (36731.9)  
PI (pH):   %s   4.36 (4.31) Peptide Signal:   %s   cut: 19 range:19-362
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKQLFATLSAALVAQAAITKRVACPDGKNTAINAACCNLFTARDDIQKNMFDGGQCNDVAHQAIRLIFHDAVAFSPALTAQGKFGGNGADGSIMTFDTIETAFHPNIGLDEIVNIEKPFAQFHNMTPGDFIHFAGAVAVTNCPGAPTLTFSIGRPPVAAAPDGLVPEPFHTADQIFARMLDALQFDELETVWALIAHTVGASNDVDPSIPRTPFDSTPSLFDGQFFIDTQLRGTAFPGQNGLQGEVESPLKGEIRLQSDHVIARDTRSACEWQSFANDHDKLTNRFQFVVETLAMVGQDPTNMIDCTEVIPIPQDLTAAQLTPMFPAGQTLADVEQCADTPFPSFATRPGPATAVPAV*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAACAACTCTTCGCTACTCTCTCCGCAGCCCTCGTGGCACAGGCCGCGATCACTAAGCGTGTTGCTTGCCCCGACGGCAAGAACACCGCTATCAACGCGGCATGCTGCAAC
TTGTTCACCGCCCGCGACGACATTCAAAAGAACATGTTCGACGGCGGCCAGTGCAACGATGTTGCTCACCAGGCTATCCGACT
GTGAGCTTCTGTTGACAGCAGTACTACTCGAAAGCTG
ATCGTTGTACAGGATCTTCCACGACGCCGTCGCATTCTCCCCAGCTCTGACTGCTCAGGGCAAGTTCGGGTACGTGACGACGTATAGTGATTATTTGCAACATTCTAACCCTTACCTGCA
GTGGCAATGGCGCTGACGGGTCCATCATGACCTTCGACACTATCGAGACCGCCTTTCACCCCAACATCGGTCTCGACGAGATCGTCAACATTGAAAAGCCGTTCGCGCAGTTCCACAACA
TGACCCCTGGTGATTTCATTCACTTCGCGGGTGCCGTTGCTGTCACCAACTGCCCTGGTGCACCAACGCTGACCTTCTCCATCGGCCGCCCCCCAC
GTACGCCATCACTTTTTCTAAAAT
TACTACGTCCATTCATTAATTGTCTGCTATTTCTAGCGGTCGCTGCTGCTCCCGATGGCCTCGTTCCCGAGCCGTTCCACACCGCAGACCAGATCTTCGCTCGCATGCTCGACGCTCTCC
AATTTGATGAGCTTGAGACCGTCTGGGCCCTGATTGCCCACACTGTCGGTGCCTCGAACGATGTCGATCCATCCATTCCGCGCACACCCTTCGACTCTACTCCCTCCCTGTTCGACGGTC
AATTCTTCATTGACACTCAGCTTCGCGGTACTGCGTTCCCCGGCCAGAACGGCCTCCAGGGTGAAGTCGAATCCCCGCTCAAGGGCGAAATTCGTCTCCAGTCCGACCACGTCATCGCCC
GTGACACTCGCTCTGCTTGCGAGTGGCAGTCCTTCGCCAACGACCACGACAAACTTACCAACCGATTCCAATTTGTTGTCGAGACCCTCGCGATGGTTGGCCAGGACCCGACGAACATGA
TTGACTGTACCGAGGTCATTCCCATCCCCCAGGACCTGACCGCTGCGCAGCTCACCCCCATGTTCCCCGCTGGCCAAACTCTTGCTGATGTTGAGCAAGCC
GTACGCACCCATCCCTGTC
TCTTGGGCAGAAGAACTCGCTGACAAAGTATCTTACAGTGCGCTGACACCCCCTTCCCGTCCTTTGCGACTCGCCCCGGCCCTGCCACTGCCGTTCCTGCTGTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAACAACTCTTCGCTACTCTCTCCGCAGCCCTCGTGGCACAGGCCGCGATCACTAAGCGTGTTGCTTGCCCCGACGGCAAGAACACCGCTATCAACGCGGCATGCTGCAAC
TTGTTCACCGCCCGCGACGACATTCAAAAGAACATGTTCGACGGCGGCCAGTGCAACGATGTTGCTCACCAGGCTATCCGACT
GATCTTCCACGACGCCGTCGCATTCTCCCCAGCTCTG
ACTGCTCAGGGCAAGTTCGG
TGGCAATGGCGCTGACGGGTCCATCATGACCTTCGACACTATCGAGACCGCCTTTCACCCCAACATCGGTCTCGACGAGATCGTCAACATTGAAAAGCCG
TTCGCGCAGTTCCACAACATGACCCCTGGTGATTTCATTCACTTCGCGGGTGCCGTTGCTGTCACCAACTGCCCTGGTGCACCAACGCTGACCTTCTCCATCGGCCGCCCCCCAC
CGGTC
GCTGCTGCTCCCGATGGCCTCGTTCCCGAGCCGTTCCACACCGCAGACCAGATCTTCGCTCGCATGCTCGACGCTCTCCAATTTGATGAGCTTGAGACCGTCTGGGCCCTGATTGCCCAC
ACTGTCGGTGCCTCGAACGATGTCGATCCATCCATTCCGCGCACACCCTTCGACTCTACTCCCTCCCTGTTCGACGGTCAATTCTTCATTGACACTCAGCTTCGCGGTACTGCGTTCCCC
GGCCAGAACGGCCTCCAGGGTGAAGTCGAATCCCCGCTCAAGGGCGAAATTCGTCTCCAGTCCGACCACGTCATCGCCCGTGACACTCGCTCTGCTTGCGAGTGGCAGTCCTTCGCCAAC
GACCACGACAAACTTACCAACCGATTCCAATTTGTTGTCGAGACCCTCGCGATGGTTGGCCAGGACCCGACGAACATGATTGACTGTACCGAGGTCATTCCCATCCCCCAGGACCTGACC
GCTGCGCAGCTCACCCCCATGTTCCCCGCTGGCCAAACTCTTGCTGATGTTGAGCAAGCC
TGCGCTGACACCCCCTTCCCGTCCTTTGCGACTCGCCCCGGCCCTGCCACTGCCGTTCCT
GCTGTGTAA

Retrieve as FASTA