Entry information : TsPrx73 (Thhalv10004576m)
Entry ID 9754
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-18 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-17 (Christophe Dunand)
Peroxidase information: TsPrx73 (Thhalv10004576m)
Name (synonym) TsPrx73 (Thhalv10004576m)
Class Class III peroxidase    [Orthogroup: Prx011]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsPrx73
start..stop
S start..stop
BrPrx73-1Aa_other 612 0 1..329 1..329
BstrPrx21 586 0 1..329 1..329
CrubPrx63 583 0 1..329 1..329
BrPrx73-1Ab_other 583 0 1..329 1..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 535870..536085 216 N° 2 536178..536378 201 N° 3 536503..536668 166 N° 4 536791..537197 407
join(535870..536085,536178..536378,536503..536668,536791..537197)


exon

Literature and cross-references TsPrx73 (Thhalv10004576m)
DNA ref. Phytozome 12:   scaffold_6 (535870..537197)
Protein sequence: TsPrx73 (Thhalv10004576m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (304)
PWM (Da):   %s   35803.48 (33114.1)  
PI (pH):   %s   9.92 (10.01) Peptide Signal:   %s   cut: 26 range:26-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARFGMVLAVALCLTISVIPDTTTAQLKTDFYKSSCPNVERTVRTVVQQKVKQTFVTIPATLRLFFHDCFVNGCDASVLIQSTPDNKAEKDHPDNVSLAGDGFDVVIKAKKALDAIPSCRNKVSCADILALATRDVVVAAGGKSYPVELGRRDGLVSTAASVHGNLPGPNDNVDKLNKLFAKNKLTQEDMVALSAAHTVGFAHCSKVFNRIYNFNRTHSVDPTLNKAYAKDLQAACPKNVDPRIAINIDPVSPRKFDNIYFKNLQNGKGLFTSDQVLYTDRRSRPTVDAWAKNSAAFDAAFGRAMTKLGRVGVKTGRNGNIRRDCGAFN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCGGTTTGGTATGGTTCTCGCCGTGGCTCTTTGCCTCACCATCTCCGTGATTCCGGACACAACCACTGCTCAGCTCAAAACCGATTTCTACAAAAGCTCATGTCCAAATGTTGAA
CGTACAGTGAGGACAGTTGTCCAACAAAAAGTCAAACAGACATTCGTCACCATCCCAGCTACTCTCCGTCTCTTCTTCCACGATTGCTTCGTCAAC
GTAACGCTCAAAACTTTTGGTGGT
TTTTTTCTATATTTGAAACCTATAGCTAGTATGATTAGTTAAAAAGTTTTACTTGTTTCAATATATAGGGATGTGATGCGTCAGTCCTGATTCAATCAACGCCTGACAACAAAGCCGAGA
AGGATCATCCAGACAACGTGTCTTTGGCCGGAGATGGATTCGATGTTGTGATCAAAGCCAAGAAAGCCCTTGACGCAATCCCAAGTTGCAGAAACAAAGTTTCTTGTGCTGATATCCTTG
CCTTGGCCACCCGAGATGTTGTTGTCGCG
GTGAGTTATATTATAAAAACAATTATCGGTTCAATCTTAAAAAAAAAAAAAAAAAAAATATAGGTCAAAAGTACGAAACTTTTTGGTTATA
ACTATTAAATGTAGCTTTTTTGGATGTGTTTAGGCTGGAGGAAAGTCGTACCCAGTGGAACTCGGTAGGCGAGACGGTTTGGTGTCGACGGCTGCAAGCGTCCACGGAAACTTGCCAGGA
CCAAATGACAACGTTGACAAACTCAACAAGCTCTTTGCCAAAAACAAACTTACTCAAGAGGATATGGTCGCCCTTTCAG
GTACCAAATTATATAACTCTCATGCGTTTCTCTATCTTAAT
ATGAGACTTCCTAACAAATGAAAATGAAAGGTGATCCATTTAATGATCTTAACCGTTAAAAATATTCTCCAAACGATGCAGCGGCTCACACCGTCGGATTCGCTCACTGTAGCAAAGTAT
TCAACAGAATCTACAACTTCAACCGCACACACTCCGTTGATCCAACTCTAAACAAAGCCTACGCTAAGGATCTTCAAGCGGCTTGTCCCAAGAACGTTGATCCAAGAATCGCTATTAACA
TTGACCCAGTCTCTCCAAGAAAGTTCGACAACATTTACTTCAAGAATCTGCAAAACGGCAAAGGACTCTTCACTTCCGATCAAGTTCTCTACACCGATCGTCGCTCTAGGCCCACCGTTG
ACGCTTGGGCCAAGAACTCCGCTGCTTTCGACGCCGCCTTTGGAAGAGCTATGACCAAACTCGGCCGTGTTGGCGTTAAGACTGGACGCAACGGTAACATCCGTCGCGACTGTGGAGCGT
TTAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCGGTTTGGTATGGTTCTCGCCGTGGCTCTTTGCCTCACCATCTCCGTGATTCCGGACACAACCACTGCTCAGCTCAAAACCGATTTCTACAAAAGCTCATGTCCAAATGTTGAA
CGTACAGTGAGGACAGTTGTCCAACAAAAAGTCAAACAGACATTCGTCACCATCCCAGCTACTCTCCGTCTCTTCTTCCACGATTGCTTCGTCAAC
GGATGTGATGCGTCAGTCCTGATT
CAATCAACGCCTGACAACAAAGCCGAGAAGGATCATCCAGACAACGTGTCTTTGGCCGGAGATGGATTCGATGTTGTGATCAAAGCCAAGAAAGCCCTTGACGCAATCCCAAGTTGCAGA
AACAAAGTTTCTTGTGCTGATATCCTTGCCTTGGCCACCCGAGATGTTGTTGTCGCG
GCTGGAGGAAAGTCGTACCCAGTGGAACTCGGTAGGCGAGACGGTTTGGTGTCGACGGCTGCA
AGCGTCCACGGAAACTTGCCAGGACCAAATGACAACGTTGACAAACTCAACAAGCTCTTTGCCAAAAACAAACTTACTCAAGAGGATATGGTCGCCCTTTCAG
CGGCTCACACCGTCGGA
TTCGCTCACTGTAGCAAAGTATTCAACAGAATCTACAACTTCAACCGCACACACTCCGTTGATCCAACTCTAAACAAAGCCTACGCTAAGGATCTTCAAGCGGCTTGTCCCAAGAACGTT
GATCCAAGAATCGCTATTAACATTGACCCAGTCTCTCCAAGAAAGTTCGACAACATTTACTTCAAGAATCTGCAAAACGGCAAAGGACTCTTCACTTCCGATCAAGTTCTCTACACCGAT
CGTCGCTCTAGGCCCACCGTTGACGCTTGGGCCAAGAACTCCGCTGCTTTCGACGCCGCCTTTGGAAGAGCTATGACCAAACTCGGCCGTGTTGGCGTTAAGACTGGACGCAACGGTAAC
ATCCGTCGCGACTGTGGAGCGTTTAACTAG

Retrieve as FASTA