Entry information : SbPrx75 (Sobic.004G105800.1 [2.1] / SB04G008630 [1.4])
Entry ID 976
Creation 2010-01-07 (Christophe Dunand)
Last sequence changes 2010-01-07 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx75 (Sobic.004G105800.1 [2.1] / SB04G008630 [1.4])
Name (synonym) SbPrx75 (Sobic.004G105800.1 [2.1] / SB04G008630 [1.4])
Class Class III peroxidase     [Orthogroup: Prx018]*
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type Callus
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx75
start..stop
S start..stop
SiPrx77 485 1e-174 1..321 1..321
SbPrx74 478 1e-171 4..320 3..325
HvPrx13 474 3e-170 10..320 11..322
BdiPrx99 470 1e-168 1..320 1..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10063872..10064084 213 N° 2 10063216..10063404 189 N° 3 10062525..10063088 564  
complement(join(10062525..10063088,10063216..10063404,10063872..10064084))


exon

Literature and cross-references SbPrx75 (Sobic.004G105800.1 [2.1] / SB04G008630 [1.4])
Literature Cordonnier-Pratt, M.-M. et al., unpublished.
DNA ref. Phytozome 12:   chromosome_4 (10064084..10062525)
Protein sequence: SbPrx75 (Sobic.004G105800.1 [2.1] / SB04G008630 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321 (298)
PWM (Da):   %s   34030.93 (31605.8)  
PI (pH):   %s   5.29 (4.90) Peptide Signal:   %s   cut: 24 range:24-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MACSFRALLHCLLALSLCSTAYGGQLTPTFYALSCPALEPIVRTTMTKAIINDRRMGASLLRLFFHDCFVLGCDGSILLDDAGSFVGEKTALPNASIRGYEVIDQIKANVEAVCPGVVSCADIVALAARDGTVLLGGPTWAVPLGRRDSTTASLSQANSDIPAPTLNLDSLILAFGKKGLSPADMTALSGAHTIGYAECEDFRGHIYNDTNVDPAFAALRQRNCPAESGSGDTNLAPLDVQTRYVFDNAYYRNLMVRQGLLHSDQELFNGGSQDALVQQYSTDPGLFASHFVAAMIKMGNIGTLTGSQGQIRADCRVVNSR*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, introns 1 and 2). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGCAGCTTCAGGGCCTTGTTGCATTGCTTGCTTGCCTTGTCCCTCTGCTCCACGGCATATGGTGGGCAGCTCACGCCGACGTTCTACGCACTGAGCTGCCCGGCGCTTGAGCCC
ATCGTGCGCACCACCATGACCAAGGCCATCATCAACGACCGTCGGATGGGCGCCTCCCTCCTCAGGCTCTTCTTCCATGACTGCTTCGTCCTG
GTAATTGCTGGCGGCTTGGCCGGTCTT
TAACGTTAGGGTGTGTTTAGTTTTCCATAGAATACAAAATATAAAATACCAAATATTTTGGAATGATGAAATACAAAATGAAAAAATTTGTATGGGTGTGTTAAGTTCTATCCAAAATAC
CATAAAATTTTCACGGTCCAAAATATATATATATGAAGCTGCTCTTTTGAGCCTTTTTTGGCTCTTGAAGTCAAATTCCAGAATAAAAAATGACAACCATTTTACTAAAAGTTTTGGATG
GTGTTTACTTTCATTCTACACAATGGTGGACGAAAACCTAACATTGTTTTTGTTCCAAATGAGGAACTAAACAGGCCCTTATTAATAATCAAACACATAGCACGAACAATACACGTGCTC
CTAGCTAGCTAGCTAGCTAGCTAGTACTCCGTAGGCGTTCTTAGTAACATATATATCGAGAAATATTCGCTCACACGCAGGGTTGCGATGGCTCAATTCTCCTGGATGACGCGGGGAGCT
TCGTCGGCGAGAAGACCGCTCTCCCCAACGCCTCCATCCGCGGCTACGAGGTCATCGACCAGATCAAGGCTAACGTCGAGGCCGTCTGCCCCGGCGTGGTCTCTTGCGCCGACATCGTCG
CCCTCGCCGCGCGGGACGGCACCGTCCTG
GTATATATACATAGAAATAATGTATTTATTCATATTACACGTACACCTGCCTGCCTACCATGCATGCTTAATCATGCATGGACATTGCACT
TGCATTTTGGTTATTTTTGGGCATGCATACATGCAGCTCGGCGGCCCAACCTGGGCGGTCCCGCTGGGTCGGCGCGACTCAACAACGGCGAGCCTGAGCCAGGCGAACAGCGACATTCCG
GCGCCGACGCTGAACCTGGACTCGCTTATCTTGGCGTTCGGCAAGAAGGGCCTGAGCCCGGCGGACATGACGGCACTCTCCGGCGCGCATACCATCGGCTACGCGGAGTGCGAGGACTTC
CGCGGCCACATCTACAACGACACCAACGTCGACCCGGCGTTCGCCGCCCTGCGGCAGCGCAACTGCCCCGCCGAGTCGGGCTCCGGCGACACCAACCTCGCGCCGCTCGACGTGCAGACG
CGGTACGTCTTCGACAACGCCTACTACCGCAACCTGATGGTCAGGCAAGGTCTGCTGCACTCGGACCAGGAGCTCTTCAACGGCGGGTCGCAGGACGCGCTGGTGCAGCAGTACAGCACC
GACCCGGGGCTCTTCGCGTCACACTTTGTTGCCGCTATGATAAAGATGGGGAACATCGGAACGCTCACCGGAAGCCAAGGACAGATCAGGGCCGACTGCAGGGTCGTCAACAGTCGTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGCAGCTTCAGGGCCTTGTTGCATTGCTTGCTTGCCTTGTCCCTCTGCTCCACGGCATATGGTGGGCAGCTCACGCCGACGTTCTACGCACTGAGCTGCCCGGCGCTTGAGCCC
ATCGTGCGCACCACCATGACCAAGGCCATCATCAACGACCGTCGGATGGGCGCCTCCCTCCTCAGGCTCTTCTTCCATGACTGCTTCGTCCTG
GGTTGCGATGGCTCAATTCTCCTGGAT
GACGCGGGGAGCTTCGTCGGCGAGAAGACCGCTCTCCCCAACGCCTCCATCCGCGGCTACGAGGTCATCGACCAGATCAAGGCTAACGTCGAGGCCGTCTGCCCCGGCGTGGTCTCTTGC
GCCGACATCGTCGCCCTCGCCGCGCGGGACGGCACCGTCCTG
CTCGGCGGCCCAACCTGGGCGGTCCCGCTGGGTCGGCGCGACTCAACAACGGCGAGCCTGAGCCAGGCGAACAGCGAC
ATTCCGGCGCCGACGCTGAACCTGGACTCGCTTATCTTGGCGTTCGGCAAGAAGGGCCTGAGCCCGGCGGACATGACGGCACTCTCCGGCGCGCATACCATCGGCTACGCGGAGTGCGAG
GACTTCCGCGGCCACATCTACAACGACACCAACGTCGACCCGGCGTTCGCCGCCCTGCGGCAGCGCAACTGCCCCGCCGAGTCGGGCTCCGGCGACACCAACCTCGCGCCGCTCGACGTG
CAGACGCGGTACGTCTTCGACAACGCCTACTACCGCAACCTGATGGTCAGGCAAGGTCTGCTGCACTCGGACCAGGAGCTCTTCAACGGCGGGTCGCAGGACGCGCTGGTGCAGCAGTAC
AGCACCGACCCGGGGCTCTTCGCGTCACACTTTGTTGCCGCTATGATAAAGATGGGGAACATCGGAACGCTCACCGGAAGCCAAGGACAGATCAGGGCCGACTGCAGGGTCGTCAACAGT
CGTTAG

Retrieve as FASTA