Entry information : TsPrx67 (Thhalv10014097m)
Entry ID 9776
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-18 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-26 (Christophe Dunand)
Peroxidase information: TsPrx67 (Thhalv10014097m)
Name (synonym) TsPrx67 (Thhalv10014097m)
Class Class III peroxidase    [Orthogroup: Prx054]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsPrx67
start..stop
S start..stop
BrPrx68-1Aa_other 540 0 1..326 1..324
BrPrx67-1Aa_other 517 0 11..326 1..316
AtPrx68 509 0 1..326 1..325
AhalPrx62 499 3e-180 1..326 1..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 8898701..8898928 228 N° 2 8899061..8899252 192 N° 3 8899819..8900379 561  
join(8898701..8898928,8899061..8899252,8899819..8900379)


exon

Literature and cross-references TsPrx67 (Thhalv10014097m)
DNA ref. Phytozome 12:   scaffold_2 (8898701..8900379)
Protein sequence: TsPrx67 (Thhalv10014097m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (299)
PWM (Da):   %s   35695.98 (32422.6)  
PI (pH):   %s   9.85 (10.08) Peptide Signal:   %s   cut: 28 range:28-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEYNNKQGSMLLMVVLMMMTMWSCGYSEAKLSRDFYSESCPSLFPAVRRVVQHAVAKERRMAASLLRLFFHDCFVNGCDGSILLDDTSSFVGEKTAGPNNNSVRGFEVIDRIKSKVERLCPGVVSCADILAITARDSVLLLGGPKWGVKLGRRDSTKASFSDANSGVIPPPTSTLNNLINRFKAKGLSTRDMVALSGAHTIGQARCVTFRNRIHNASNIDLSFALSRQMSCPAASGSGDNNEAALDPRSPGRFDLSYYKQLLKHRGLLTSDQVLFNGGSTDSLVVAYGYSLKAFYRDFVRAMIKMGDISPLTGSNGQIRNNCRRPN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAATACAATAATAAGCAGGGAAGTATGCTATTAATGGTGGTGTTGATGATGATGACAATGTGGAGCTGTGGTTACAGCGAGGCCAAGCTGAGCAGAGACTTCTACTCGGAAAGCTGT
CCCTCACTGTTCCCAGCGGTGAGACGGGTCGTGCAGCATGCGGTTGCCAAAGAGCGTCGCATGGCTGCTTCTCTCCTCCGTTTGTTTTTCCACGACTGTTTCGTAAAC
GTAACTCTTCTT
TTTTTCTTTTTCTATTTTCTTTTTTGAATGAAACATGCATGGTATATGTTCCCATGAATTACTCCAGGAAATTTCAAAAAAAAGAAGTAATTAATTGGTCGGAAATGGTTTATATTACAG

GGGTGTGACGGATCCATATTGCTGGACGACACTTCCTCATTTGTGGGAGAGAAAACCGCAGGACCAAACAATAACTCTGTGAGGGGATTCGAAGTGATCGACAGAATCAAGTCCAAGGTT
GAGAGACTCTGTCCTGGCGTCGTCTCATGCGCAGACATTCTCGCCATCACTGCTCGTGACTCTGTCCTCCTC
GTTAGCACCTCTCTACCTTTACTTCTAATTTCGAATAACATCGTTTTT
CTTTAGCGCATTCCCAAATAAATAGAACATTCTAACGAGTTCGCAACCTCAAATTTACTTATTTCACATATTTTCCATATTTTAGGGTAATTTGAGACGACAAACTATACATTATAATAT
CGGACCGGTTCAAAAATAATAAATGACGTCCAAAGCAAGAATTTTAAGTGTGTTCATCCTCTGCTTAGTTATACCAACATTTAAAAAAAAAAAAATTATCTTCTTTATTTACCAACATTT
ATTTCCAAACAATCTTATTGACTTTTTGTTTCAAATGTATTTAAACTATTTTTGACGACGACTCTATTTATAAACTTTGAAATAGGAAATAAGACATAAGCAAAACAAACATAATCTAAT
TTGGGAAGGTGACCATAAACAGTAGCTTGTAACCACGAACTTGACCTTATTCTACATACATGCTCTCTAGATAACTTGTGTATATAGACAGTGTACGCGAAAGTATCTCCATACATATAA
TTATCTTACTAATAAATTACACCTTTTGAACTAAGCAGCTGGGTGGGCCCAAGTGGGGCGTGAAACTTGGGAGACGAGACTCCACGAAGGCCAGCTTTTCGGACGCCAACTCAGGCGTCA
TCCCACCTCCGACCTCTACTCTCAACAATCTCATCAACCGTTTTAAAGCAAAAGGCTTGTCCACACGCGACATGGTCGCTCTCTCTGGTGCGCACACCATTGGACAAGCCAGGTGTGTCA
CCTTCAGGAACCGTATCCACAACGCAAGTAACATAGACCTTTCTTTCGCCTTGTCCAGACAGATGAGCTGTCCCGCTGCCTCTGGCTCGGGAGACAACAACGAAGCTGCTCTTGACCCTC
GTTCACCTGGAAGGTTCGACCTCAGCTACTACAAGCAGCTTCTCAAACACAGGGGTCTGCTCACTTCAGATCAAGTCCTTTTCAATGGCGGCTCCACTGACTCGCTCGTTGTAGCCTACG
GCTACAGTCTCAAAGCTTTTTACCGCGACTTTGTAAGAGCTATGATTAAGATGGGTGATATCAGCCCCCTCACCGGATCCAATGGTCAGATCCGCAACAACTGTCGCAGGCCCAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAATACAATAATAAGCAGGGAAGTATGCTATTAATGGTGGTGTTGATGATGATGACAATGTGGAGCTGTGGTTACAGCGAGGCCAAGCTGAGCAGAGACTTCTACTCGGAAAGCTGT
CCCTCACTGTTCCCAGCGGTGAGACGGGTCGTGCAGCATGCGGTTGCCAAAGAGCGTCGCATGGCTGCTTCTCTCCTCCGTTTGTTTTTCCACGACTGTTTCGTAAAC
GGGTGTGACGGA
TCCATATTGCTGGACGACACTTCCTCATTTGTGGGAGAGAAAACCGCAGGACCAAACAATAACTCTGTGAGGGGATTCGAAGTGATCGACAGAATCAAGTCCAAGGTTGAGAGACTCTGT
CCTGGCGTCGTCTCATGCGCAGACATTCTCGCCATCACTGCTCGTGACTCTGTCCTCCTC
CTGGGTGGGCCCAAGTGGGGCGTGAAACTTGGGAGACGAGACTCCACGAAGGCCAGCTTT
TCGGACGCCAACTCAGGCGTCATCCCACCTCCGACCTCTACTCTCAACAATCTCATCAACCGTTTTAAAGCAAAAGGCTTGTCCACACGCGACATGGTCGCTCTCTCTGGTGCGCACACC
ATTGGACAAGCCAGGTGTGTCACCTTCAGGAACCGTATCCACAACGCAAGTAACATAGACCTTTCTTTCGCCTTGTCCAGACAGATGAGCTGTCCCGCTGCCTCTGGCTCGGGAGACAAC
AACGAAGCTGCTCTTGACCCTCGTTCACCTGGAAGGTTCGACCTCAGCTACTACAAGCAGCTTCTCAAACACAGGGGTCTGCTCACTTCAGATCAAGTCCTTTTCAATGGCGGCTCCACT
GACTCGCTCGTTGTAGCCTACGGCTACAGTCTCAAAGCTTTTTACCGCGACTTTGTAAGAGCTATGATTAAGATGGGTGATATCAGCCCCCTCACCGGATCCAATGGTCAGATCCGCAAC
AACTGTCGCAGGCCCAATTGA

Retrieve as FASTA