Entry information : TsPrx60 (Thhalv10015253m)
Entry ID 9780
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-18 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-21 (Christophe Dunand)
Peroxidase information: TsPrx60 (Thhalv10015253m)
Name (synonym) TsPrx60 (Thhalv10015253m)
Class Class III peroxidase    [Orthogroup: Prx032]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsPrx60
start..stop
S start..stop
CagraPrx05 522 0 1..328 1..330
BstrPrx69 520 0 1..328 1..330
AlyPrx60 519 0 1..329 1..330
CrubPrx121 508 0 1..328 1..330
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7589885..7590103 219 N° 2 7590215..7590394 180 N° 3 7590489..7590654 166 N° 4 7590741..7591168 428
join(7589885..7590103,7590215..7590394,7590489..7590654,7590741..7591168)


exon

Literature and cross-references TsPrx60 (Thhalv10015253m)
DNA ref. Phytozome 12:   scaffold_2 (7589885..7591168)
Protein sequence: TsPrx60 (Thhalv10015253m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (304)
PWM (Da):   %s   36016.15 (33189.6)  
PI (pH):   %s   6.5 (5.77) Peptide Signal:   %s   cut: 27 range:27-330
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAKISTKSALIVFLAVLSISQCCYGKLEFGSYKETCPNVENIVFKVVKEGFIKDPSVAPAMIRLYFHDCFSNGCDASLLLDGTSSEKKATPNLSVRGYELLDDIKTALENDCHGVVSCADIIALATRDLVTLASGEKTRYEIPTGRLDGRESTALSVDLPSPQLSVSQTAAMFAKRKLSVDDMVLLLGGHTIGVAHCSFIKDRLYNFKNTNKPDPSMDPKLVQELRGKCPEKSSTDGIINLDQDFSSSNIVDVSFYKQINSSRGILQIDQELANDGMTKKMVTDLAKGNDFLARFGQAMVNLGSVGVKDEQNGEIRRSCRSCNNLFCTK*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGCGAAGATCTCGACCAAATCAGCATTGATCGTCTTTCTTGCTGTGCTTAGCATCAGCCAATGTTGTTATGGCAAGCTTGAGTTCGGATCCTACAAAGAAACTTGCCCAAACGTC
GAAAACATCGTATTTAAAGTTGTTAAAGAGGGATTTATCAAGGACCCATCCGTTGCACCCGCAATGATCCGGCTTTATTTTCACGATTGTTTTAGCAAC
GTAAGTTGATTAACTCTTCTT
ATTATATATACGTAAAATGTTTAAAAATGTTCTAAAGAGTCTTAAAGGAAGCAGTGATTGATCTTGTATGTATCAAAACAATGTATGTAGGGATGTGATGCATCGCTTCTTCTCGATGGT
ACGAGCAGCGAGAAAAAGGCAACACCAAATCTAAGTGTACGAGGATATGAGTTGCTAGATGACATTAAAACCGCGCTCGAAAATGATTGCCACGGGGTCGTTTCTTGTGCTGATATCATA
GCTCTCGCTACTAGAGATCTTGTTACTCTT
GTAAGTAAATACACTCTATTCTTGTATCTACATTTTTATATGTCATGTTTCCCTAATCAAATGAGGAAAAATAATTTAAAATTTTGATTT
GAAGGCAAGCGGAGAGAAAACAAGATATGAGATACCAACAGGAAGACTTGATGGTAGGGAATCTACGGCGTTGTCAGTGGATTTGCCGTCTCCTCAATTGAGTGTCTCGCAAACCGCTGC
GATGTTTGCTAAAAGAAAACTTAGCGTCGACGATATGGTTCTACTTCTTG
GTATGAAAAATATTTCATAACATACTAAATTTTGATGATAAATATGATCTTATAATTATTTAATTTTGTG
TTTGTTTTTTCAATAGGTGGACATACAATTGGAGTAGCGCATTGTTCATTTATCAAGGACCGGTTATATAATTTTAAAAATACGAACAAACCTGATCCATCTATGGATCCTAAGTTGGTT
CAAGAGTTGAGAGGAAAATGTCCTGAGAAATCTTCAACTGATGGCATTATTAATCTGGATCAGGATTTCTCGAGTTCGAACATTGTCGATGTATCTTTCTACAAACAGATAAATTCTAGT
AGAGGAATCCTTCAAATTGATCAAGAACTCGCCAACGATGGAATGACGAAAAAGATGGTGACGGATTTAGCCAAGGGCAACGATTTCTTGGCTAGGTTTGGTCAGGCTATGGTGAATTTG
GGATCGGTAGGAGTTAAAGATGAGCAGAATGGGGAGATCAGAAGATCGTGTCGTTCTTGCAACAATCTGTTTTGCACAAAATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGCGAAGATCTCGACCAAATCAGCATTGATCGTCTTTCTTGCTGTGCTTAGCATCAGCCAATGTTGTTATGGCAAGCTTGAGTTCGGATCCTACAAAGAAACTTGCCCAAACGTC
GAAAACATCGTATTTAAAGTTGTTAAAGAGGGATTTATCAAGGACCCATCCGTTGCACCCGCAATGATCCGGCTTTATTTTCACGATTGTTTTAGCAAC
GGATGTGATGCATCGCTTCTT
CTCGATGGTACGAGCAGCGAGAAAAAGGCAACACCAAATCTAAGTGTACGAGGATATGAGTTGCTAGATGACATTAAAACCGCGCTCGAAAATGATTGCCACGGGGTCGTTTCTTGTGCT
GATATCATAGCTCTCGCTACTAGAGATCTTGTTACTCTT
GCAAGCGGAGAGAAAACAAGATATGAGATACCAACAGGAAGACTTGATGGTAGGGAATCTACGGCGTTGTCAGTGGATTTG
CCGTCTCCTCAATTGAGTGTCTCGCAAACCGCTGCGATGTTTGCTAAAAGAAAACTTAGCGTCGACGATATGGTTCTACTTCTTG
GTGGACATACAATTGGAGTAGCGCATTGTTCATTT
ATCAAGGACCGGTTATATAATTTTAAAAATACGAACAAACCTGATCCATCTATGGATCCTAAGTTGGTTCAAGAGTTGAGAGGAAAATGTCCTGAGAAATCTTCAACTGATGGCATTATT
AATCTGGATCAGGATTTCTCGAGTTCGAACATTGTCGATGTATCTTTCTACAAACAGATAAATTCTAGTAGAGGAATCCTTCAAATTGATCAAGAACTCGCCAACGATGGAATGACGAAA
AAGATGGTGACGGATTTAGCCAAGGGCAACGATTTCTTGGCTAGGTTTGGTCAGGCTATGGTGAATTTGGGATCGGTAGGAGTTAAAGATGAGCAGAATGGGGAGATCAGAAGATCGTGT
CGTTCTTGCAACAATCTGTTTTGCACAAAATAA

Retrieve as FASTA