Entry information : TsPrx21 (Thhalv10016921m)
Entry ID 9787
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-18 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-28 (Christophe Dunand)
Peroxidase information: TsPrx21 (Thhalv10016921m)
Name (synonym) TsPrx21 (Thhalv10016921m)
Class Class III peroxidase    [Orthogroup: Prx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsPrx21
start..stop
S start..stop
ThPrx21 685 0 1..328 1..328
BstrPrx19 649 0 4..328 3..327
AlyPrx21 642 0 1..328 1..327
BnPrx21-2_other 637 0 1..328 1..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 9067564..9067642 79 N° 2 9067199..9067347 149 N° 3 9066893..9067081 189 N° 4 9066617..9066785 169
N° 5 9066071..9066471 401  
complement(join(9066071..9066471,9066617..9066785,9066893..9067081,9067199..9067 347,9067564..9067642))


exon

Literature and cross-references TsPrx21 (Thhalv10016921m)
Literature Taji,T., Sakurai,T., Mochida,K., Ishiwata,A., Kurotani,A., Totoki,Y., Toyoda,A., Sakaki,Y., Seki,M., Ono,H., Sakata,Y., Tanaka,S. and Shinozaki,K. BMC Plant Biol. 8, 115 (2008).
DNA ref. Phytozome 12:   scaffold_10 (9067642..9066071)
EST ref. GenBank:   BAJ34558
Protein sequence: TsPrx21 (Thhalv10016921m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (299)
PWM (Da):   %s   36725.43 (33398.7) Transmb domain:   %s   i7-29o
PI (pH):   %s   7.2 (6.71) Peptide Signal:   %s   cut: 30 range:30-328
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAIAKKPFCLLAFFCLLLQLFSTFHTGNGELEMNYYRESCPKAEEIIRQQVETLYYKHGNTAVSWLRNLFHDCVVKSCDASLLLETARGVESEQKSTRSFGMRNFKYVKTIKDALEKACPNTVSCADIVALSARDGIVMLKGPKIEMIKTGRRDSRGSYLGDVETLIPNHNDSLSSVLSTFNSIGIDVEATVALLGAHSVGRVHCVNLVHRLYPTIDPTLDPSYALYLKNRCPTPNPDPNAVLYSRNDRETPMVVDNMYYKNIMAHKGLLVIDDELASDPRTAPFVAKMASDNSYFHEQFSRGVTLLSETNPLTGDQGEIRKDCRYVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns) and 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCATTGCGAAGAAGCCTTTCTGCCTTTTGGCCTTCTTTTGTCTGTTATTACAGTTATTCTCTACCTTCCATACCGGTAAATATTCTTTCCTGATCCAATCACGTTTCGCCACATGT
TTCCATGCCTCTCGAAATTTTGCTGACTGGAGCTGCCTATGTAGTGATATATATTTCTTTTCGTAATTTATTTTCCATCGTAAAAATCCAGGAAATATATTTGTGATAATAATCGCTAAT
AAACGCATATATGTGTAATGGAAACGAATAATTTTAAGAAGTAATAAAACTGTAGGAAATGGGGAGCTGGAGATGAATTATTACAGAGAGAGTTGTCCAAAAGCGGAAGAGATAATAAGA
CAACAAGTGGAGACTCTTTACTACAAACACGGCAACACCGCCGTTTCTTGGCTCCGTAATCTCTTCCATGACTGTGTCGTCAAG
GTAATTTTTTTCTTTCTATTCACATGAGACATGAGG
AATTTAGTTATTATCATCATAATAGAATATCAAAATACGATTTATATCTATGTCAACATGTGTGTGTGTGTGTGTGTGTAGTCATGTGATGCGTCGCTGTTGCTAGAGACAGCAAGAGGT
GTGGAATCTGAGCAAAAATCGACGAGGAGTTTTGGGATGAGAAACTTTAAGTATGTTAAGACTATCAAAGACGCACTCGAGAAAGCGTGTCCGAACACAGTGTCTTGTGCCGATATTGTC
GCTCTCTCTGCTAGAGATGGTATTGTCATG
GTGCGTACGTAGACTCCCCATATATTTCTATGCATTTTTACGGCTAATTTGATTAGTTGTATTTTTTTTAATACTAAATTTTTTGTTGTT
GTTTAAATTATAAATAGTTGAAAGGGCCAAAAATAGAGATGATAAAGACAGGAAGGAGAGATAGCAGAGGGAGCTACTTGGGAGATGTTGAGACTCTAATTCCTAACCACAATGACTCCC
TCTCCTCTGTTCTCTCAACTTTCAACTCTATCGGCATCGATGTCGAAGCCACCGTCGCTCTCTTAG
GTATCTTTTAATAGCAAAGTAATGACATTATTACTTTATTATACGGAAATAAAA
AGTTACCATATTACTTTTCTTGGAGAAAATGTACTTTCTTAAAAATAGGAATGATGTTGATTTTGATTGGTCAATTTATATGTAACTGTAGGTGCTCACTCAGTGGGTAGGGTCCACTGC
GTTAACCTAGTGCACCGGCTATACCCAACGATCGACCCGACCCTCGACCCAAGTTACGCCCTTTACTTGAAAAATCGTTGCCCAACTCCAAACCCGGATCCGAACGCCGTCTTGTACTCC
CGCAACGACCGTGAGACTCCGATGGTTGTTGACAACATGTATTACAAGAACATCATGGCTCATAAGGGTCTCCTTGTCATCGATGACGAGCTAGCCTCTGATCCTAGGACCGCTCCTTTT
GTGGCTAAGATGGCTTCCGACAATTCTTACTTCCATGAGCAGTTCTCACGCGGTGTCACGCTCTTGTCCGAGACCAACCCGCTCACTGGAGACCAAGGGGAGATCAGGAAGGATTGTCGT
TATGTGAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCATTGCGAAGAAGCCTTTCTGCCTTTTGGCCTTCTTTTGTCTGTTATTACAGTTATTCTCTACCTTCCATACCGGAAATGGGGAGCTGGAGATGAATTATTACAGAGAGAGTTGT
CCAAAAGCGGAAGAGATAATAAGACAACAAGTGGAGACTCTTTACTACAAACACGGCAACACCGCCGTTTCTTGGCTCCGTAATCTCTTCCATGACTGTGTCGTCAAG
TCATGTGATGCG
TCGCTGTTGCTAGAGACAGCAAGAGGTGTGGAATCTGAGCAAAAATCGACGAGGAGTTTTGGGATGAGAAACTTTAAGTATGTTAAGACTATCAAAGACGCACTCGAGAAAGCGTGTCCG
AACACAGTGTCTTGTGCCGATATTGTCGCTCTCTCTGCTAGAGATGGTATTGTCATG
TTGAAAGGGCCAAAAATAGAGATGATAAAGACAGGAAGGAGAGATAGCAGAGGGAGCTACTTG
GGAGATGTTGAGACTCTAATTCCTAACCACAATGACTCCCTCTCCTCTGTTCTCTCAACTTTCAACTCTATCGGCATCGATGTCGAAGCCACCGTCGCTCTCTTAG
GTGCTCACTCAGTG
GGTAGGGTCCACTGCGTTAACCTAGTGCACCGGCTATACCCAACGATCGACCCGACCCTCGACCCAAGTTACGCCCTTTACTTGAAAAATCGTTGCCCAACTCCAAACCCGGATCCGAAC
GCCGTCTTGTACTCCCGCAACGACCGTGAGACTCCGATGGTTGTTGACAACATGTATTACAAGAACATCATGGCTCATAAGGGTCTCCTTGTCATCGATGACGAGCTAGCCTCTGATCCT
AGGACCGCTCCTTTTGTGGCTAAGATGGCTTCCGACAATTCTTACTTCCATGAGCAGTTCTCACGCGGTGTCACGCTCTTGTCCGAGACCAACCCGCTCACTGGAGACCAAGGGGAGATC
AGGAAGGATTGTCGTTATGTGAACTAA

Retrieve as FASTA