Entry information : TsAPx02 (Thhalv10021381m)
Entry ID 9799
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-21 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-30 (Christophe Dunand)
Peroxidase information: TsAPx02 (Thhalv10021381m)
Name (synonym) TsAPx02 (Thhalv10021381m)
Class Ascorbate peroxidase    [Orthogroup: APx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsAPx02
start..stop
S start..stop
TparAPx02 495 0 1..250 1..250
AhalAPx07 489 2e-178 3..250 4..251
AtAPx02 486 2e-177 3..250 4..251
AlyAPx02 485 5e-177 3..250 4..251
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 6452153..6452271 119 N° 2 6451880..6452054 175 N° 3 6451571..6451636 66 N° 4 6451336..6451384 49
N° 5 6451163..6451245 83 N° 6 6450997..6451076 80 N° 7 6450814..6450916 103 N° 8 6450666..6450724 59
N° 9 6450441..6450465 25  
complement(join(6450441..6450465,6450666..6450724,6450814..6450916,6450997..6451 076,6451163..6451245,6451336..6451384,6451571..6451636,6451880..6452054,6452153. .6452271))


exon

Literature and cross-references TsAPx02 (Thhalv10021381m)
DNA ref. Phytozome 12:   scaffold_13 (6452271..6450441)
Protein sequence: TsAPx02 (Thhalv10021381m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   253
PWM (Da):   %s   28213.57  
PI (pH):   %s   6.24
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVKSYPEVTEDYKKAIQRCKRKLRGLIAEKHCAPIVLRLAWHSAGTFDVKTKTGGPYGTIRHPQELAHDANNGLDIAVRLLDPIKELFPILSYADFYQLAGVVAVEITGGPEIPFHPGRLDKVEPPPEGRLPQATKGVDHLRDVFGRMGLNDKDIVALSGGHTLGRCHKERSGFEGPWTQNPLIFDNSYFKEILSGEKEGLLQLPTDKALLQDPLFRPLVERYAADEDAFFEDYTEAHLKLSELGFAENEKE*

Retrieve as FASTA  
Remarks Complete sequence from genomic. No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGAAGAGTTACCCGGAAGTGACGGAAGATTACAAGAAAGCTATTCAGAGATGTAAGAGGAAGCTACGTGGTCTCATCGCTGAGAAGCACTGTGCTCCCATCGTCCTCCGTCTTGCG
TAAGATCAATGGCTTCTATCGTTTTTGATGAATCGGTGATGCGTCTGTGATTTGTTTTTATATATATTTTGTTGTTGTTGTTGGGGAAAATTTGCAGATGGCACTCGGCTGGGACATTTG
ACGTGAAGACGAAGACGGGAGGGCCGTATGGGACGATAAGGCATCCGCAAGAGCTAGCCCATGATGCTAACAATGGTCTTGATATTGCTGTCAGGCTTCTTGACCCCATCAAAGAGCTCT
TCCCCATCTTGTCCTACGCTGATTTCTACCAG
GTAAAATTTCATTTCAACAATGTTCTGACTTCTTTTTTCTTTAAAGTTGTCATAGCTAGAAAAGGGATGCATCGAACTGTAGTAATTA
GGAGCTTGACCTGTTTATCATTGCCTCTCTCGTTTGTTTGCATTGAACTTGATTCACGCATATGATAGATAGAGTGAAACTGTATCTAAAAGCTAATCTTATATTTTGACATGACTTTTA
AAGGGCTTGATTCACATGTGTTTCTTGGATTGTAGCTAGCTGGAGTTGTTGCTGTTGAGATCACTGGAGGACCCGAGATTCCATTTCATCCTGGTAGACTGGTGAGTATTATTCAACTAC
CAATTTTTTTGCCTCATCTATCTTCAGTTCGCAGTTTCTTTGTGTTGAAGCTCAATTCACTGATCATGGTCTGTCAAAGACACCACCAAAGTGAAATTCTCTCTTTCTCTCTTAAGTTCT
TTTAAGCATTGCTCATGTGATTAACTGATACAAACGTCTTCTTTCAGGACAAAGTTGAGCCACCTCCTGAAGGTCGTCTACCTCAGGCCACCAAAGGTATATCAGTTGTAACGAAAATGC
ATATAGTCTGACTCAGATCATATATTATAACATGGACTCACCATCTTTTTCTTACGATAAATTCAGGAGTGGATCACCTGAGAGATGTATTTGGTCGGATGGGACTCAATGACAAAGATA
TTGTGGCATTGTCCGGTGGACACACTTTG
GTATGTCTGCTGCATCCAGAAAAAAAAAGTAAAGACCTATGTCCATTTCTCAGTTTTGGCTCTTACTAATAATGTTTTACTTTCAGGGCCG
GTGCCACAAGGAACGCTCGGGATTCGAGGGACCATGGACACAAAACCCTCTCATTTTCGACAACTCATATTTCAA
GTAAGACCAGTCTTTCCTCCTTCTTCCTCAGGTTTCGTCATTCTA
TGATTGGACCGAGGCTGAATGTGGTCGTGAAACAGAGAGATATTAAGCGGAGAGAAAGAAGGACTTCTGCAGCTGCCAACCGACAAGGCTCTTCTCCAGGATCCTCTCTTTCGTCCCCTG
GTTGAGAGATATGCTGCA
GTAAGTTATACAACTCAACCATCATCTCATGATTCTCATCAATCATATCATTTGGATTTGTTACTGATTCTACCTACGTATACTCGCAGGATGAGGATGCCT
TTTTCGAAGACTATACTGAAGCTCATCTGAAGTTGTCAGAACTCGG
GTAAGTTACACACAGAACAATTGTTTCTCGACATTTCTGAAACTTTTTCTTATTGTCCTAATGTAACGCCGTGA
TCTTTAGTTATTGTTCCTCAGAAATTTCAGAAACTTATCACTTGCAAACACATGCTTGTCTAAATCTGTTCGAACACAATGTTTTTAAGTATTTTTGTTTGATATATACGCTCATGTGCT
TGGCAGGTTTGCTGAGAATGAAAAGGAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGAAGAGTTACCCGGAAGTGACGGAAGATTACAAGAAAGCTATTCAGAGATGTAAGAGGAAGCTACGTGGTCTCATCGCTGAGAAGCACTGTGCTCCCATCGTCCTCCGTCTTGCA
TGGCACTCGGCTGGGACATTTGACGTGAAGACGAAGACGGGAGGGCCGTATGGGACGATAAGGCATCCGCAAGAGCTAGCCCATGATGCTAACAATGGTCTTGATATTGCTGTCAGGCTT
CTTGACCCCATCAAAGAGCTCTTCCCCATCTTGTCCTACGCTGATTTCTACCAG
CTAGCTGGAGTTGTTGCTGTTGAGATCACTGGAGGACCCGAGATTCCATTTCATCCTGGTAGACTG
GACAAAGTTGAGCCACCTCCTGAAGGTCGTCTACCTCAGGCCACCAAAGGAGTGGATCACCTGAGAGATGTATTTGGTCGGATGGGACTCAATGACAAAGATATTGTGGCATTGTCCGGT
GGACACACTTTG
GGCCGGTGCCACAAGGAACGCTCGGGATTCGAGGGACCATGGACACAAAACCCTCTCATTTTCGACAACTCATATTTCAAAGAGATATTAAGCGGAGAGAAAGAAGGA
CTTCTGCAGCTGCCAACCGACAAGGCTCTTCTCCAGGATCCTCTCTTTCGTCCCCTGGTTGAGAGATATGCTGCA
GATGAGGATGCCTTTTTCGAAGACTATACTGAAGCTCATCTGAAG
TTGTCAGAACTCGG
GTTTGCTGAGAATGAAAAGGAGTAA

Retrieve as FASTA