Entry information : TsAPx23-1 (Thhalv10023023m / ThAPx23-1)
Entry ID 9830
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-29 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-04 (Christophe Dunand)
Peroxidase information: TsAPx23-1 (Thhalv10023023m / ThAPx23-1)
Name (synonym) TsAPx23-1 (Thhalv10023023m / ThAPx23-1)
Class Ascorbate peroxidase     [Orthogroup: APx013]*
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsAPx23-1
start..stop
S start..stop
TsAPx23-2 482 4e-174 1..283 1..282
AlyAPx23-2 471 1e-169 2..283 4..286
CrubAPx03-2 469 4e-169 3..283 4..284
AlyAPx23 455 1e-163 1..283 1..286
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2879869..2879981 113 N° 2 2880136..2880268 133 N° 3 2880706..2880755 50 N° 4 2881330..2881398 69
N° 5 2881490..2881538 49 N° 6 2881745..2881827 83 N° 7 2881921..2882009 89 N° 8 2882120..2882225 106
N° 9 2882395..2882514 120 N° 10 2882566..2882682 117  
join(2879869..2879981,2880136..2880268,2880706..2880755,2881330..2881398,2881490 ..2881538,2881745..2881827,2881921..2882009,2882120..2882225,2882395..2882514,28 82566..2882682)


exon

Literature and cross-references TsAPx23-1 (Thhalv10023023m / ThAPx23-1)
DNA ref. Phytozome 12:   scaffold_11 (2879869..2882682)
Protein sequence: TsAPx23-1 (Thhalv10023023m / ThAPx23-1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   303
PWM (Da):   %s   33411.86  
PI (pH):   %s   5.14
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVSLVVGAEYLKQIDKARRELRAVIAQKNCAPIMLRLSWHDAGTYDAKSNTGRPIGSIRNEEEYTHGANNGLKVALDLCEDVKSKLPKISYADLYQQLAGVVAVEVTGGPDISFIPGRKDSNACTDEGRLPDANQGFKHLKDVFYRMGLSDKDIVALSGAHTLGRAHPERSGFDGPWTQDPLKFDNSYFVKLLKEEESEILLKLSNDKTLLEVPEFRHYAELYAKEEDAFFRDYAESHKKLSELGFTPTSSVTKETTESTKLSISKLGVAVAAALVACSYFSERNASSSDLFGYDGEDFVDLV

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (3' end is missing; Short PS in frame is missing which has been completed). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGTCACTCGTCGTTGGCGCGGAGTACCTTAAGCAGATCGATAAAGCTCGCCGTGAACTCCGTGCTGTTATCGCTCAGAAGAATTGCGCTCCGATCATGCTCCGATTATCGTAAGTT
TCCATTTCTGTCGTCTTATTTCGCGATTCCCTGGTGCTGAGCGCGACGAGGTTTATTTCCTGTGGAAATTTGAGAAAATCTCGCGCTATTTTGGAATATTGCTTACTGCATTTGCGATCT
CATGTTTGTCTTCTCTGGTTTGTTAAGGTGGCATGATGCTGGAACCTACGATGCCAAATCGAACACCGGTAGACCTATTGGCTCGATTAGGAACGAAGAAGACTANGAAGAGTACACTCA
TGGTGCCAATAATGGTTTGAAAGTTGCTCTCGATCTCTGT
GGTGCGTTTTTCTTTTTTCCATTCTCTGCGGATTTGAAGATTCGAGTGGAAAATCGATTTAGGGATTTCGTTTCCTAGCT
TGTCTATGCAGTCTTTGTTTGCACTAAACTGTTTATAGGAGACGAGAATTTCCTCATTTGGAACCCTATATAATATCGATTTCGAAATCTTTCTAAATATACGTTATCGTTTGAAACATT
GACCTTAATAGGATTTTGTGTTGCCTATGTTTCTCCCGGATCGTTCTTTTCAGTAGTCCTGAGGATTTATGAGAAGTTTCACATGTTAAATCTGTTAGTGTGTGCCTTATATGCTTATCA
GTTTCAGAAACCTTTCCCTTTGTTCTCATGTGGTGTATCATGTTGTCTTATGACTTGGGAACAAAAGTTTCATAATCGGCTTATGTGGATTTTGATGTTGATTCTTTAATTTTTTCAGAG
GACGTGAAAACTAAATTTCCCAAGATCAGCTATGCGGACCTATACCA
GGTAAACTAAAACGAATTTTGCTTGAAGTTTTATGTTTGCATAAATGTTCCTACTGGATTTAAGACTGTAAAC
AAATGCTTCTTATAGTATCATTTCGCACCTTATTTTTTTGTGCTCTTTCTTCTGATTGTCCTGTGACTTTTAACTTGTTGTGTCTCATAAACTATCAAAAGCGTTGTTAGATATTTTTTT
GAGCTGTACTTGTATGATTGCTGTCCGCAGGCTCAGGATAAATAAGTTTTGTTGTTGAAATGTTTGGCTTATTTGCAATTTGAAGAATCTTCACACTCACTCACATGAACAATAATAGTC
TTTTTTGTATTCTCTGGCTTTCACAATTGTTCTTTCAAGTAAAGTATATAGATAGAGTCACAGTTATGGAGGAAGCTTAACAAAAAAAAAAGTGCCACTTGATCTTTGACTATAGTAAAC
AAATCCTGCATTTAGCTGTGTCAATAAGGTTGCGTAATAATTTCTACTAGTGGCACTCAACTATTTCACTCATCAAATTATTCTATTTAGCCCTGGACTTAATGGACCTTACATTTCACT
CGAAGTTGCTTCTGTCATTTTTCAGCTTGCGGGTGTGGTAGCGGTTGAAGTTACTGGTGGACCTGACATCAGCTTTATTCCTGGAAGAAAAGTAATATTCTCTCAGCCACTAAGATGAAT
AGTATTACAGCTTACCGCCAAATGCAATTTAACAATATAAGCTGTATGTTTCTCACTTATAGGATTCAAATGCCTGCACCGACGAAGGAAGACTTCCTGATGCTAATCAAGGTAGGATGA
AAGTTTTGTTTTCAAATAATCACAAACTCCTAAGTATTTTACTGAAAATTAAATACCTGACGTTTGTATCTGAGTGGCAAAGATAGAATGGAAGATGATCATCTAGGTGTTTCCCCAATG
TATAATATAATCATCTATTTGAATGTATATCTTTTCTCAGTGAGTGATCAAAGTTATGTCTCTAATTTTGCACCTAGGTTTCAAACATCTTAAAGATGTCTTCTACCGTATGGGACTGTC
TGATAAAGATATCGTGGCACTCTCAGGGGCTCATACTCT
GGTAAATTCTTTGTTTCGTCATTCCACATTTTTCATTTGGTATTTGATAAATAAGTTGTATATTGGTTTTGTTTAATTAGA
TTCCGATGTTTAGGGAAGGGCTCATCCAGAGAGATCAGGTTTTGATGGACCATGGACTCAAGTCACTCAAGACCCTCTTAAGTTCGATAACTCATACTTTGTGTAAGATCCTCTAAATTC
GTGGACACTTGTTTTTTTTTTTTGGTATTGGGACGACAAATATTACTTCTGACTACTGAATTGTTTACATCCAATATCGCTGCTGGTACCAGGAAATTGCTGAAAGAAGAAGAATCAGAG
ATATTGCTGAAACTTTCTAACGACAAGACTTTGTTGGAGGTCCCGGAGTTTCGTCATTACGCTGAGCTTTACGCAAA
GGTGAAAATTATGAGAGCCTGCCTTTATTCTGATCCAAAGATC
TGATTCAATTATCAATCCTGGAGCTGCAAAACGAGTTTTATAATGACAAGCCAAGATTGTGTTGCAAGTAGCATCTTGATTTGCTCTTGTTAACAACTGTATAAGTTTCCAATTTCGTCC
CAAACAGGAAGAAGATGCTTTCTTCAGAGACTATGCGGAGTCACACAAGAAACTCTCAGAGCTCGGGTTCACACCAACTTCTTCAGTCACCAAGGAGACAACAGAGAGCACCAAGCTGTC
CATATC
TCTGGGACTAGAACTTCCATCTTACAAGATAACTCTGAAACTTAAACTTACAAAGCTCGGAGTCGCAGTCGCTGCTGCTTTGGTGGCTTGTAGCTACTTCTCTGAAAGAAACGC
TTCCTCTTCCGATCTCTTTGGATATGATGGTGAAGATTTTGTTGATCTAGTATG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGTCACTCGTCGTTGGCGCGGAGTACCTTAAGCAGATCGATAAAGCTCGCCGTGAACTCCGTGCTGTTATCGCTCAGAAGAATTGCGCTCCGATCATGCTCCGATTATCGTGGCAT
GATGCTGGAACCTACGATGCCAAATCGAACACCGGTAGACCTATTGGCTCGATTAGGAACGAAGAAGACTANGAAGAGTACACTCATGGTGCCAATAATGGTTTGAAAGTTGCTCTCGAT
CTCTGT
GAGGACGTGAAAACTAAATTTCCCAAGATCAGCTATGCGGACCTATACCATCAGCTTGCGGGTGTGGTAGCGGTTGAAGTTACTGGTGGACCTGACATCAGCTTTATTCCTGGA
AGAAA
GGATTCAAATGCCTGCACCGACGAAGGAAGACTTCCTGATGCTAATCAAGGTTTCAAACATCTTAAAGATGTCTTCTACCGTATGGGACTGTCTGATAAAGATATCGTGGCACTC
TCAGGGGCTCATACTCT
GGGAAGGGCTCATCCAGAGAGATCAGGTTTTGATGGACCATGGACTCAAGTCACTCAAGACCCTCTTAAGTTCGATAACTCATACTTTGGGAAATTGCTGAAA
GAAGAAGAATCAGAGATATTGCTGAAACTTTCTAACGACAAGACTTTGTTGGAGGTCCCGGAGTTTCGTCATTACGCTGAGCTTTACGCAAA
GGAAGAAGATGCTTTCTTCAGAGACTAT
GCGGAGTCACACAAGAAACTCTCAGAGCTCGGGTTCACACCAACTTCTTCAGTCACCAAGGAGACAACAGAGAGCACCAAGCTGTCCATATC
AAAGCTCGGAGTCGCAGTCGCTGCTGCT
TTGGTGGCTTGTAGCTACTTCTCTGAAAGAAACGCTTCCTCTTCCGATCTCTTTGGATATGATGGTGAAGATTTTGTTGATCTAGTATG

Retrieve as FASTA