Entry information : SbPrx26 (Sobic.002G003500.1[2.1] / SB02G000500[1.4])
Entry ID 985
Creation 2005-12-19 (Christophe Dunand)
Last sequence changes 2015-02-04 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-02-04 (Christophe Dunand)
Peroxidase information: SbPrx26 (Sobic.002G003500.1[2.1] / SB02G000500[1.4])
Name (synonym) SbPrx26 (Sobic.002G003500.1[2.1] / SB02G000500[1.4])
Class Class III peroxidase    [Orthogroup: Prx061]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type Seedlings
Inducer Phosphate starvation
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx26
start..stop
S start..stop
ZmPrx94 599 0 21..346 24..345
SiPrx83 577 0 14..365 15..367
PvirPrx01 558 0 22..367 24..372
PvirPrx02 529 0 36..367 37..368
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 451565..451972 408 N° 2 452157..452325 169 N° 3 452434..452940 507  
join(451565..451972,452157..452325,452434..452940)


exon

Literature and cross-references SbPrx26 (Sobic.002G003500.1[2.1] / SB02G000500[1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 12:   chromosome_2 (451565..452828)
Cluster/Prediction ref. PlantGDB:   SbGSStuc11-12-04.1313.1
Protein sequence: SbPrx26 (Sobic.002G003500.1[2.1] / SB02G000500[1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   367 (341)
PWM (Da):   %s   37180.02 (34817.7) Transmb domain:   %s   o344-366i (o318-340i)
PI (pH):   %s   6.12 (6.11) Peptide Signal:   %s   cut: 27 range:27-367
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASVTAAARAAAAVLLLVVAAPSADAHLAMGAYNKTCPQAEDVVLKEMTSMVAKSPDVAGAVLRLFSVDCFVGGCEGSILLDSTPGNTAEKDAPLNQGVRGYEVVDAIKAKLDAACPAVVSCADTLALAARDSVRLTKGPFIPLPTGRRDGNRSVAADVALNSPPPGANITDIIALFATKFNLTAKDVAVLSGAHTIGKARCSTVSPRLYNFGGQNGASDPTLDANYTATLRGQCKPGDNATLVYLDPPTPTTFDTDYYALVAGNKGLLSTDAALLLDATTSAYVARQANATATAAAASEFFADFATSFVAMSKLGVLTHHNGEIRQVCSKVNPPSPSSSTSTAAAQLTATGGLAVALLALAVALVL

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, introns 2 and 3) and 2 ESTs. Frame shift between "VSPRL" and "YNFGG" (probably missing "t"). Incorrect prediction from Phytozome. Containing motif 'SVDC'. Missing 'Cys'.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCAGCGTCACCGCAGCAGCAAGAGCAGCGGCGGCGGTGCTGCTCCTGGTTGTGGCGGCGCCGTCGGCGGACGCCCACTTGGCGATGGGCGCGTACAACAAGACGTGCCCGCAGGCG
GAGGACGTGGTGTTGAAGGAGATGACGTCCATGGTGGCCAAGTCGCCGGACGTGGCGGGCGCCGTGCTCCGGCTCTTCTCCGTGGACTGCTTCGTGGGCGGCTGCGAGGGCTCCATCCTG
CTCGACTCCACACCCGGCAACACCGCCGAGAAGGACGCGCCGCTGAACCAGGGAGTCCGCGGCTACGAGGTGGTGGACGCCATCAAGGCCAAGCTCGACGCCGCTTGCCCCGCCGTCGTC
TCCTGCGCCGACACGCTCGCCCTCGCCGCGCGTGACTCCGTCAGGCTG
GTAATAATTAACGTAACTCATCATCCAAGCATCATATGCTTCATGATAGATAGATAGATAGATAGATAGATA
GATACTAGATACTATCAGTAAGAAAGAATTACTAGTACATACTGTGAAAATAGAGAGTTATTATTTGTTTCTCTGACGGCGACGACGACGACGACGATGCATATATGGGCAGACGAAAGG
CCCGTTCATCCCGCTCCCGACTGGCCGGAGGGACGGCAACAGGTCGGTGGCCGCCGACGTGGCCCTGAACTCGCCGCCGCCGGGCGCCAACATCACCGACATCATCGCCCTGTTTGCTAC
AAAGTTCAACCTCACCGCCAAGGACGTCGCTGTCCTCTCCG
GTATATATGTATCATTGTTGCCTGCTCGGCCATCATCGTGCATAAGAAGGAATTGAATGCTAATAAATCCTTGACGTAC
GGTTTTCAGGCGCACACACAATCGGGAAGGCGAGGTGCTCGACGGTGTCGCCGCGGCTNTACAACTTCGGCGGGCAGAACGGCGCGTCGGACCCCACGCTGGACGCCAACTACACGGCCA
CCCTCCGCGGGCAGTGCAAGCCCGGCGACAACGCCACCCTCGTCTACCTCGACCCTCCCACGCCGACGACCTTCGACACCGACTACTACGCCCTCGTCGCCGGCAACAAGGGCCTCCTTT
CCACCGACGCCGCCCTCCTCCTCGACGCCACCACCAGCGCCTACGTCGCGCGCCAGGCCAACGCCACCGCCACCGCGGCCGCGGCGAGCGAGTTCTTCGCCGACTTCGCAACGTCCTTCG
TCGCCATGAGCAAGCTCGGCGTGCTCACGCACCACAACGGCGAGATCAGGCAGGTCTGCTCCAAGGTCAACCCGCCGTCGCCGTCCAGCAGTACCAGCACCGCTGCTGCCCAGCTGACCG
CTACCGGTGGGTTGGCAGTGGCACTACTCGCTCTCGCTGTGGCTCTCGTGCTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCAGCGTCACCGCAGCAGCAAGAGCAGCGGCGGCGGTGCTGCTCCTGGTTGTGGCGGCGCCGTCGGCGGACGCCCACTTGGCGATGGGCGCGTACAACAAGACGTGCCCGCAGGCG
GAGGACGTGGTGTTGAAGGAGATGACGTCCATGGTGGCCAAGTCGCCGGACGTGGCGGGCGCCGTGCTCCGGCTCTTCTCCGTGGACTGCTTCGTGGGCGGCTGCGAGGGCTCCATCCTG
CTCGACTCCACACCCGGCAACACCGCCGAGAAGGACGCGCCGCTGAACCAGGGAGTCCGCGGCTACGAGGTGGTGGACGCCATCAAGGCCAAGCTCGACGCCGCTTGCCCCGCCGTCGTC
TCCTGCGCCGACACGCTCGCCCTCGCCGCGCGTGACTCCGTCAGGCTG
ACGAAAGGCCCGTTCATCCCGCTCCCGACTGGCCGGAGGGACGGCAACAGGTCGGTGGCCGCCGACGTGGCC
CTGAACTCGCCGCCGCCGGGCGCCAACATCACCGACATCATCGCCCTGTTTGCTACAAAGTTCAACCTCACCGCCAAGGACGTCGCTGTCCTCTCCG
GCGAGGTGCTCGACGGTGTCGCC
GCGGCTNTACAACTTCGGCGGGCAGAACGGCGCGTCGGACCCCACGCTGGACGCCAACTACACGGCCACCCTCCGCGGGCAGTGCAAGCCCGGCGACAACGCCACCCTCGTCTACCTCGA
CCCTCCCACGCCGACGACCTTCGACACCGACTACTACGCCCTCGTCGCCGGCAACAAGGGCCTCCTTTCCACCGACGCCGCCCTCCTCCTCGACGCCACCACCAGCGCCTACGTCGCGCG
CCAGGCCAACGCCACCGCCACCGCGGCCGCGGCGAGCGAGTTCTTCGCCGACTTCGCAACGTCCTTCGTCGCCATGAGCAAGCTCGGCGTGCTCACGCACCACAACGGCGAGATCAGGCA
GGTCTGCTCCAAGGTCAACCCGCCGTCGCCGTCCAGCAGTACCAGCACCGCTGCTGCCCAGCTGACCGCTACCGGTGGGTTGGCAGTGGCACTACTCGCTCTCGCTGTGGCTCTCGTGCT
CTAA

Retrieve as FASTA