Entry information : GmPrx327
Entry ID 9867
Creation 2011-11-29 (Qiang Li)
Last sequence changes 2015-11-03 (Achraf Jemmat)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-04 (Christophe Dunand)
Peroxidase information: GmPrx327
Name GmPrx327
Class Class III peroxidase    [Orthogroup: Prx059]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx327
start..stop
S start..stop
GmPrx31 606 0 1..328 1..329
SpolPrx37 473 2e-169 4..328 5..327
GhPrx13 469 5e-168 28..328 22..322
PtPrx41 467 2e-167 7..328 3..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4787982..4788215 234 N° 2 4786602..4786793 192 N° 3 4785720..4785888 169 N° 4 4784499..4784890 392
complement(join(4784499..4784890,4785720..4785888,4786602..4786793,4787982..4788 215))


exon

Literature and cross-references GmPrx327
Protein sequence: GmPrx327
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (298)
PWM (Da):   %s   35953.48 (32878.8) Transmb domain:   %s   o15-34i
PI (pH):   %s   10.4 (10.29) Peptide Signal:   %s   cut: 31 range:31-328
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALSPIRSSSFSSSAIVALAVLLLLTGTSSANLSKNFYSKTCPNVFNTVKSVVKSAVVREPRIGASIVRLFFHDCFVQGCDGSILLDDTPTFQGEKTAAANNNSVRGFEVIDAIKSEVEKICPGVVSCADILDLASRDSVVLLGGPFWKVRLGRRDSRTANFTAANTGVIPPPTSNLTNLITRFRDQGLSARDMVALSGAHTFGKARCTSFRDRIYNQTNIDRTFALARQRRCPRTNGTGDNNLANLDFRTPNHFDNNYFKNLLIKRGLLNSDQVLFNGGSTDSLVRTYSQNNKAFDTDFVKAMIRMGDIKPLTGSQGEIRKNCRRVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCACTTTCTCCTATTCGTTCTTCTTCTTTCTCTTCATCAGCTATTGTTGCATTGGCTGTGTTACTGCTTCTTACAGGGACCTCTTCAGCTAACCTCTCAAAGAACTTCTATTCCAAG
ACATGTCCCAACGTTTTCAACACTGTAAAATCTGTAGTTAAATCTGCTGTTGTCAGAGAACCTCGCATTGGGGCATCTATTGTTCGTCTCTTCTTCCATGACTGCTTTGTTCAA
GTAATT
TACTCCTAACCTTTATACTAGTTTTTTTTTTCTTCTACTAGAGTATGACTTTTTTTAATGGTATATCAGTGTGAAGTATTTATTGGCTAATTTTACTGAAAAACCTAACTAACATATCAC
TTTTAATAGGATTTTTCTTACCAATTATATTTTTTACTACTAGATTATTAGGACTTTTGCATGTGATATGATCTTTTTTGTTCATGAAGTAACTCTTTTTAGCTATCTACATTTTGGGGC
TATATAGCTCATGTCCTTTTTTCAAAACCTCTCCATAATTTTCTCAGTTAAGATCTCACTGGTGATGACAAGTACATATATGATATAACTCATGCATCTTTCACTTGTCTTTTAACAATG
CAAACGTTGTAAATAAATAACTTAACTTTTTTTTCACTCATTAATTTTATATTTTTTACCTCTCTCTTGGTAAATCAATGGTTATATTTATCACTTTTTGTTACCGACTAATATAATACA
CAGACACTTGTACTGAGATATTAACGTAGCACGGTGCGTTGATTTGACACTAAGAAATTGATTTTGTCCTCTTTCAGTAATGTTATTCAAAACAAAAATTAATTTTGATAAGTTTTTAAT
TTATTATACGTTTATTAATAATGATAGCAGATAGTTTCCGGGTAAATATGTAGTATTTTTCATTCTTTTTAAAAACCAAAACATATTATCTTTAAGTAATTATTATTTTTACTTCATGTT
TTTATAAATGAATATATATAAATATCATATTATTTTAAAATATTTCTTGCTTTCAAAGTTTGTAAAAAAAAAGTGAAAAAAAAAACATTTTTCAATTCAAAATTTTATGAACAGAAAATT
AATAAAATAAAATAGCAATTTTATTATGATTTATTAAAACATAAAATAATAATAATAATATTTTCTCAAATCAAAACATAGTATCCTAAATTCATTCAAAATTATAGTCCTATTTGGATA
AGCTTCTATATATAAGCACTTATATGAAAAGAAAATTAAAAAAAAAAAAAAAAACTCTTCCGTAAACTAAAATCAACTTATGCATGAATTTTAATTAAATTTTTTTGGATAAATTAAAAT
TTAACTAATTCTTTTTGCCTTCAAAAGATCTCTGAATCAAATTTATGGTAATTCTTTGGTCATGTTTGAGATATATGATTGATGGTGCTTTAATGGAAACAGGGCTGTGATGGGTCAATA
CTACTTGATGACACTCCAACCTTCCAGGGGGAGAAAACTGCAGCTGCTAACAACAATTCAGTGAGAGGCTTTGAAGTAATTGATGCTATCAAGTCTGAGGTCGAGAAAATATGCCCTGGT
GTGGTCTCCTGTGCTGATATCTTGGACCTTGCTTCTCGTGACTCTGTTGTCCTT
GTGAGTTCAAACCTAATTAATCTGCTAACAATCGAGTTTAATAAGCCTAGATCAGAAATAATTTTT
AATATGAATTTTAAGATGATTATTATAAAAATTAATAATTTTATCATACATAATTAATTATTTATGATTAAATGAAAATATAAAAAACTTTTACGCTATATATTAGTATATTATTATTTG
TTGTATTAATGTAATGAGACATATTGTTAGTGTAGAGTTACAACGTTTATATTAACAGTGTATATCTATGCAAAAAGTATGATTCACCAACGATATATATTAATTTCTCATATCAATAAA
ATTATATATCAATGTGTTACATCGATCTAACACAATAGACATCAAGAAAATTGAATCTAACAGAATGGATTACTTCCTCAAAACGTGACAAATTAAGATTTGAATTCCTTCGTAAGAGGT
ATTTATATTTAATATTCATCTATGTTTCATACAGGGTTATCTAAACAAACAAAAAAAAATATTTGTGAAAAACCAAAAATAATAACAGTATAGACTTATAATATTTATACTAATTATCAT
ATCTGCATTACATAAAGTTTATAGCAAAGAAGTTAATTAAGTCTAATGATTCTATCATTAGCATATAAATTATATTTGTTTGTAGTGTGATTTTCCAAACATATTTGATAAATATGTCGT
TTCTGAACTTTGAAGTCCTTAAAATATTTATTTGTTGTATTGTGCAGCTTGGAGGGCCATTTTGGAAAGTTAGACTTGGAAGAAGGGATTCCAGAACTGCCAACTTTACTGCTGCTAACA
CTGGTGTTATTCCACCTCCCACATCTAACCTCACCAACCTTATCACAAGGTTTCGAGATCAAGGACTCTCTGCTAGGGACATGGTTGCTTTATCTG
GTATTTCTCTTTTTTCTTCTTTAT
CTTATTTTTCCCCATCTTTGATCTCTCCCTTCCATTATATGAACAATTACTCCTTTTGTCTGTGTTTAGTTGAGACTTGAGACACGTTTTAATATCGGTTTTGCATATAACAGTGATTTT
TCCTTTCCAAAATTCATACTAGAATGTGACATTTAAACAACCACATGCATTGGATCAAGTCCTTTTTCTAAGTTTGAAGTCATGTCCTTAAATAGTAACACATTTAAGCAACAAGAAAGG
CACATTTAACCAACCAAGAATCATCCATGATTTTTCAATGTACGGGGAAATAAGTGAATCTAATATTAGGATTGACCTAATGGTGAAAATTAAAATTTCACAAAATCTTAAGTTCAAACC
TTGTTGTCTGTCATTGAAAAAAAAATATATTTCATATATAACTATAAAATATGAATAACAAGCAATTTCATAAATCAACAGAAATTACAGCTACATTATAGTTATGGGATTTAGTAACCT
CAAATTCTCTAAATAGAGAGAATGAAGTTAATAATCAAAAAATAATAAAGAAATACTCTATTTCGAGAGTCCTCCATATATTTAATTTATCATTCATAAAAGTAAGTAAATAATATGAAT
TTAATTAGAATGTCTTATCTAATGAGATTTCTAATTAGTTGACACTGTAAAAAAATATTTACACTAACAGCGCATGAAAATTAAACTTAATAATTATTAGTGAGACTAGTACATGAGACT
AACAACAGTAAATCAGTTATTAAAAATTATATAGGAATACTGAAAATTTCTATTTATGATATTATGTGTGTGGTTTCACTTGCAGGAGCTCACACATTTGGCAAAGCAAGGTGTACTAGT
TTCAGAGATCGCATATACAATCAAACCAACATTGATAGAACATTTGCATTGGCCAGGCAGAGGAGGTGTCCTAGGACTAATGGCACAGGTGACAACAATCTAGCAAATCTAGACTTCAGA
ACTCCAAATCATTTTGACAACAACTACTTCAAAAACCTTCTCATCAAAAGGGGACTCCTGAATTCTGATCAAGTGCTTTTCAATGGTGGATCCACTGATTCACTGGTAAGAACTTACAGC
CAGAATAACAAGGCATTTGATACTGACTTTGTTAAAGCAATGATTAGGATGGGAGATATCAAACCCTTAACTGGGTCACAAGGTGAGATTAGGAAGAACTGCAGGAGAGTGAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCACTTTCTCCTATTCGTTCTTCTTCTTTCTCTTCATCAGCTATTGTTGCATTGGCTGTGTTACTGCTTCTTACAGGGACCTCTTCAGCTAACCTCTCAAAGAACTTCTATTCCAAG
ACATGTCCCAACGTTTTCAACACTGTAAAATCTGTAGTTAAATCTGCTGTTGTCAGAGAACCTCGCATTGGGGCATCTATTGTTCGTCTCTTCTTCCATGACTGCTTTGTTCAA
GGCTGT
GATGGGTCAATACTACTTGATGACACTCCAACCTTCCAGGGGGAGAAAACTGCAGCTGCTAACAACAATTCAGTGAGAGGCTTTGAAGTAATTGATGCTATCAAGTCTGAGGTCGAGAAA
ATATGCCCTGGTGTGGTCTCCTGTGCTGATATCTTGGACCTTGCTTCTCGTGACTCTGTTGTCCTT
CTTGGAGGGCCATTTTGGAAAGTTAGACTTGGAAGAAGGGATTCCAGAACTGCC
AACTTTACTGCTGCTAACACTGGTGTTATTCCACCTCCCACATCTAACCTCACCAACCTTATCACAAGGTTTCGAGATCAAGGACTCTCTGCTAGGGACATGGTTGCTTTATCTG
GAGCT
CACACATTTGGCAAAGCAAGGTGTACTAGTTTCAGAGATCGCATATACAATCAAACCAACATTGATAGAACATTTGCATTGGCCAGGCAGAGGAGGTGTCCTAGGACTAATGGCACAGGT
GACAACAATCTAGCAAATCTAGACTTCAGAACTCCAAATCATTTTGACAACAACTACTTCAAAAACCTTCTCATCAAAAGGGGACTCCTGAATTCTGATCAAGTGCTTTTCAATGGTGGA
TCCACTGATTCACTGGTAAGAACTTACAGCCAGAATAACAAGGCATTTGATACTGACTTTGTTAAAGCAATGATTAGGATGGGAGATATCAAACCCTTAACTGGGTCACAAGGTGAGATT
AGGAAGAACTGCAGGAGAGTGAATTAA

Retrieve as FASTA