Entry information : ZmPrx93 (GRMZM2G108221)
Entry ID 989
Creation 2007-11-16 (Christophe Dunand)
Last sequence changes 2015-12-15 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-12-15 (Achraf Jemmat)
Peroxidase information: ZmPrx93 (GRMZM2G108221)
Name (synonym) ZmPrx93 (GRMZM2G108221)
Class Class III peroxidase    [Orthogroup: Prx195]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type Roots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx93
start..stop
S start..stop
SbPrx34 563 0 1..326 1..325
SiPrx126 511 0 1..326 1..308
OsPrx4849 448 4e-160 17..326 3..313
SiPrx157 439 4e-156 31..326 32..330
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 75871..76107 237 N° 2 76207..76398 192 N° 3 76545..76714 170 N° 4 76969..77350 382
join(75871..76107,76207..76398,76545..76714,76969..77350)


exon

Literature and cross-references ZmPrx93 (GRMZM2G108221)
Literature Walbot,V., unpublished
DNA ref. GenBank:   AC197343.2 (75871..77348)
Cluster/Prediction ref. UniGene:   Zm.4894 [3' end]
Protein sequence: ZmPrx93 (GRMZM2G108221)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (295)
PWM (Da):   %s   33348.83 (30124.0)  
PI (pH):   %s   8.49 (7.70) Peptide Signal:   %s   cut: 32 range:32-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAACISHRFRHSKLPVLVLALATVVAAARAQLSPPTFYASSCPAALVTINAAVRAAVLLDRRMGASLLRLHFHDCFVQGCDASVLLDDTGNFTGEKSAGPNAGSLRGFGVIDTVKALLEALCPRTVSCADILAVAARDSVVALGGPSWTVQLGRRDSTTASLSTANTDLPSPASSLSTLLAAFARKGLSSTDMVALSGAHTVGQAQCQNYQARIYNDANINAAFAASLRAGCPASGGGGANAPLDASTPNAFDNAYYGDLVAQQGLLHSDQELFNGGSTDALVRSYAASSARFSSDFAAAMVRMGAIGVLTGSSGQVRRNCRKVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 7, 3 introns) and 8 ESTs. Cultivar="W23". Incorrect prediction from Phytozome (first exon is missing due to large intron 1).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCTGCGTGCATCAGCCATCGCTTTCGCCACTCCAAGCTCCCGGTACTGGTCCTGGCGCTGGCGACGGTGGTGGCCGCCGCACGGGCTCAGCTGTCGCCGCCGACGTTCTACGCC
TCGTCGTGCCCTGCCGCGCTCGTCACCATCAACGCCGCCGTGAGGGCTGCCGTGCTGCTGGACCGCCGCATGGGGGCCTCCCTGCTCCGGCTCCACTTCCACGACTGCTTCGTGCAG
GCA
AGTCACAGTCCACAGCAGCCGGTCGATACTTCGTGAACAGCTGCAAAGTCATGTAACGAGTCGTGTGTCTGCCCGTGTATGTGCGCTGTGCGCCAGGGCTGCGACGCGTCCGTTCTGCTG
GACGACACGGGCAACTTCACCGGGGAGAAGAGCGCGGGCCCCAACGCGGGCTCGCTCAGGGGGTTCGGCGTCATCGACACCGTCAAGGCCCTGCTGGAGGCGCTGTGCCCGCGGACCGTG
TCGTGCGCCGACATCCTCGCCGTCGCCGCCCGTGACTCTGTCGTCGCG
GTACGAACGAATGGCCATCCCAGTCATGAGCCAGAGCAGTAGCATCCACTGGTCACTGAGGACGAGACTCCG
GCAGTCCGATCCGTGAGAAGTGAACGCTCAGTTAACATCATTGTCTATTTGTCTTGGCGATTCTGCGTGTGCAGCTCGGAGGCCCATCGTGGACCGTGCAGCTCGGCAGGAGGGACTCCA
CCACGGCGAGCCTCTCCACCGCGAACACCGACCTCCCCTCGCCGGCGTCCAGCCTGAGTACCCTGCTCGCCGCATTCGCCAGGAAAGGCCTCAGCAGCACTGACATGGTCGCTCTGTCTG
GTGC
GTCCTCACCGATCAATCAACCACGGATCACGCTTTCATCAGTGACCAGTCATCACCGCAGCGCCTGGCTTCACATCACAGTGATGTTATGGCATGGTCACCGACGTGACCATGCAA
CTACCAGTTCCCCTGTGCCTCTACTCTAACAGCGGTGGCAGCTTGGCAGTTAGCACCAGCGCGGCAGCGCCACCGCCCCACCGCCACGTACTGGTCACCACTGACACGTGAGCGGTTGCG
TATGCATGATGCAGGAGCCCACACGGTGGGGCAAGCGCAGTGCCAGAACTACCAGGCCAGGATCTACAACGACGCCAACATCAACGCGGCCTTCGCGGCGTCGCTGAGGGCCGGCTGCCC
GGCGTCCGGAGGGGGCGGCGCCAACGCGCCGCTGGACGCGTCCACGCCGAACGCGTTCGACAACGCGTACTACGGCGATCTGGTCGCGCAGCAGGGCCTGCTGCACTCCGATCAAGAGCT
CTTCAACGGTGGCTCCACGGACGCACTGGTCAGGAGCTACGCGGCCAGCTCGGCGCGGTTCAGTAGCGACTTCGCCGCAGCCATGGTCAGGATGGGCGCCATTGGTGTCCTGACCGGGAG
CAGCGGACAGGTGCGGCGCAACTGCCGGAAGGTGAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCTGCGTGCATCAGCCATCGCTTTCGCCACTCCAAGCTCCCGGTACTGGTCCTGGCGCTGGCGACGGTGGTGGCCGCCGCACGGGCTCAGCTGTCGCCGCCGACGTTCTACGCC
TCGTCGTGCCCTGCCGCGCTCGTCACCATCAACGCCGCCGTGAGGGCTGCCGTGCTGCTGGACCGCCGCATGGGGGCCTCCCTGCTCCGGCTCCACTTCCACGACTGCTTCGTGCAG
GGC
TGCGACGCGTCCGTTCTGCTGGACGACACGGGCAACTTCACCGGGGAGAAGAGCGCGGGCCCCAACGCGGGCTCGCTCAGGGGGTTCGGCGTCATCGACACCGTCAAGGCCCTGCTGGAG
GCGCTGTGCCCGCGGACCGTGTCGTGCGCCGACATCCTCGCCGTCGCCGCCCGTGACTCTGTCGTCGCG
CTCGGAGGCCCATCGTGGACCGTGCAGCTCGGCAGGAGGGACTCCACCACG
GCGAGCCTCTCCACCGCGAACACCGACCTCCCCTCGCCGGCGTCCAGCCTGAGTACCCTGCTCGCCGCATTCGCCAGGAAAGGCCTCAGCAGCACTGACATGGTCGCTCTGTCTGGTGC
C
CACACGGTGGGGCAAGCGCAGTGCCAGAACTACCAGGCCAGGATCTACAACGACGCCAACATCAACGCGGCCTTCGCGGCGTCGCTGAGGGCCGGCTGCCCGGCGTCCGGAGGGGGCGGC
GCCAACGCGCCGCTGGACGCGTCCACGCCGAACGCGTTCGACAACGCGTACTACGGCGATCTGGTCGCGCAGCAGGGCCTGCTGCACTCCGATCAAGAGCTCTTCAACGGTGGCTCCACG
GACGCACTGGTCAGGAGCTACGCGGCCAGCTCGGCGCGGTTCAGTAGCGACTTCGCCGCAGCCATGGTCAGGATGGGCGCCATTGGTGTCCTGACCGGGAGCAGCGGACAGGTGCGGCGC
AACTGCCGGAAGGTGAACTAG

Retrieve as FASTA