Entry information : ZmPrx94
Entry ID 990
Creation 2005-12-12 (Christophe Dunand)
Last sequence changes 2014-01-16 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2014-03-27 (Christophe Dunand)
Peroxidase information: ZmPrx94
Name ZmPrx94
Class Class III peroxidase    [Orthogroup: Prx061]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type Roots
Inducer Salt stress
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx94
start..stop
S start..stop
SiPrx83 577 0 14..365 16..365
SbPrx26 554 0 25..333 22..333
PvirPrx01 546 0 16..333 15..331
PvirPrx02 514 0 39..363 37..369
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1063212..1063628 417 N° 2 1063720..1063888 169 N° 3 1063982..1064493 512  
join(1063212..1063628,1063720..1063888,1063982..1064493)


exon

Literature and cross-references ZmPrx94
Literature Walbot,V., unpublished
DNA ref. GenBank:   AC189073.3 (159475..160756)
Cluster/Prediction ref. UniGene:   Zm.35222
Protein sequence: ZmPrx94
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   366 (336)
PWM (Da):   %s   37241.24 (34478.7)  
PI (pH):   %s   6.12 (5.69) Peptide Signal:   %s   cut: 30 range:30-365
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASVVAAARAAAAVVLLLAVSTTAPSADAHVVIGAYNKTCPQAEDVVLKEMTAIVAKSPDLAGAVLRLFSVDCFVGGCEGSILLDSTAGNTAEKDAALNQGVRGYEVVDAIKARLDAACPGVVSCADTLALAARDSVRLTKGPFIPLPTGRRDGNRSVAADVALNSPPPDANITDIIALFAKKFNLTAKDVAVLSGAHTIGKARCSTVSPRLYNFGGQNGASDPTLDANYTATLRGQCKPGDNATLVYLDPPTPTTFDADYYTLVAGNKGLLSTDAALLLDTTTSAYVASQANATAPATEFFADFATSFVAMSKLGALTHHNGEIRQVCSKVNPPTSSQLSNAAAVPGGLAVSLALAVVALVLKL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 7, introns 2 and 3) and 2 ESTs. Cultivar="B73". Containing motif SVDC instead of FHDC.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCAGCGTCGTCGCAGCAGCAAGAGCGGCGGCGGCAGTGGTGCTGCTCCTGGCTGTGTCGACGACGGCGCCGTCAGCGGATGCCCACGTGGTGATCGGCGCGTACAACAAGACGTGC
CCGCAGGCGGAGGACGTGGTGCTCAAGGAGATGACGGCCATCGTGGCCAAGTCGCCGGACCTCGCGGGCGCCGTGCTCCGCCTCTTCTCCGTCGACTGCTTCGTGGGTGGCTGCGAGGGC
TCCATCCTGCTCGACTCCACCGCCGGCAACACCGCCGAGAAGGACGCGGCACTGAACCAGGGCGTCCGCGGGTACGAGGTGGTGGACGCCATCAAGGCTAGGCTCGACGCCGCCTGCCCC
GGCGTCGTCTCCTGCGCTGACACGCTCGCGCTCGCCGCGCGTGACTCCGTCAGGCTG
GTATGGTAACCGCGCCGAGCATATGCATGCTTGATGTCAGCTAGCAAGAAAGAAAGAAAGAAA
GAAATTGATTAAATTAATGCATGGGCAGACGAAAGGCCCGTTCATCCCGCTCCCGACTGGCCGGAGGGACGGCAACAGGTCGGTGGCCGCCGACGTCGCCCTGAACTCGCCGCCGCCGGA
CGCCAACATCACCGATATCATCGCCCTGTTTGCTAAAAAGTTCAACCTCACCGCCAAGGACGTCGCCGTCCTCTCCG
GTATGTATTATTATCGTTATATGGTTAAACTGAATTACATACC
ATTATCATCTGTCTCTTTTATTAATTTGCGTTGCTTACGAAATTCTTGAGGCGCACACACAATCGGGAAGGCGCGGTGCTCCACGGTGTCGCCGCGGCTGTACAACTTCGGCGGGCAGAA
CGGCGCGTCCGACCCCACGCTGGACGCCAACTACACGGCCACCCTTCGCGGCCAGTGCAAGCCCGGCGACAACGCCACCCTCGTCTACCTCGACCCTCCCACGCCCACCACCTTCGACGC
CGACTACTACACCCTCGTCGCCGGCAACAAGGGCCTGCTCTCCACAGACGCCGCCCTCCTCCTCGACACCACCACTAGCGCCTACGTCGCGAGCCAGGCCAACGCCACCGCGCCGGCGAC
CGAGTTCTTCGCCGACTTCGCCACGTCCTTCGTCGCCATGAGCAAGCTGGGCGCGCTCACGCACCACAATGGAGAGATCAGGCAGGTCTGCTCCAAGGTCAACCCGCCGACGTCGTCCCA
GCTGTCCAACGCAGCCGCCGTCCCCGGTGGGTTGGCAGTGTCACTCGCTCTAGCTGTGGTGGCTCTCGTGCTAAAGCTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCAGCGTCGTCGCAGCAGCAAGAGCGGCGGCGGCAGTGGTGCTGCTCCTGGCTGTGTCGACGACGGCGCCGTCAGCGGATGCCCACGTGGTGATCGGCGCGTACAACAAGACGTGC
CCGCAGGCGGAGGACGTGGTGCTCAAGGAGATGACGGCCATCGTGGCCAAGTCGCCGGACCTCGCGGGCGCCGTGCTCCGCCTCTTCTCCGTCGACTGCTTCGTGGGTGGCTGCGAGGGC
TCCATCCTGCTCGACTCCACCGCCGGCAACACCGCCGAGAAGGACGCGGCACTGAACCAGGGCGTCCGCGGGTACGAGGTGGTGGACGCCATCAAGGCTAGGCTCGACGCCGCCTGCCCC
GGCGTCGTCTCCTGCGCTGACACGCTCGCGCTCGCCGCGCGTGACTCCGTCAGGCTG
ACGAAAGGCCCGTTCATCCCGCTCCCGACTGGCCGGAGGGACGGCAACAGGTCGGTGGCCGCC
GACGTCGCCCTGAACTCGCCGCCGCCGGACGCCAACATCACCGATATCATCGCCCTGTTTGCTAAAAAGTTCAACCTCACCGCCAAGGACGTCGCCGTCCTCTCCG
GCGCACACACAATC
GGGAAGGCGCGGTGCTCCACGGTGTCGCCGCGGCTGTACAACTTCGGCGGGCAGAACGGCGCGTCCGACCCCACGCTGGACGCCAACTACACGGCCACCCTTCGCGGCCAGTGCAAGCCC
GGCGACAACGCCACCCTCGTCTACCTCGACCCTCCCACGCCCACCACCTTCGACGCCGACTACTACACCCTCGTCGCCGGCAACAAGGGCCTGCTCTCCACAGACGCCGCCCTCCTCCTC
GACACCACCACTAGCGCCTACGTCGCGAGCCAGGCCAACGCCACCGCGCCGGCGACCGAGTTCTTCGCCGACTTCGCCACGTCCTTCGTCGCCATGAGCAAGCTGGGCGCGCTCACGCAC
CACAATGGAGAGATCAGGCAGGTCTGCTCCAAGGTCAACCCGCCGACGTCGTCCCAGCTGTCCAACGCAGCCGCCGTCCCCGGTGGGTTGGCAGTGTCACTCGCTCTAGCTGTGGTGGCT
CTCGTGCTAAAGCTCTGA

Retrieve as FASTA