Entry information : PcarKat02
Entry ID 9922
Creation 0000-00-00 (Christophe Dunand)
Last sequence changes 2011-12-14 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2015-12-11 (Catherine Mathe)
Peroxidase information: PcarKat02
Name PcarKat02
Class Catalase    [Orthogroup: Kat003]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phanerochaete
Organism Phanerochaete carnosa    [TaxId: 231932 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PcarKat02
start..stop
S start..stop
PcKat02 995 0 26..541 23..554
PplKat02 706 0 17..541 39..571
PinvKat02 562 0 5..514 8..530
SbreKat02 544 0 28..514 33..530
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3588106..3588316 211 N° 2 3588379..3588451 73 N° 3 3588509..3588569 61 N° 4 3588717..3588741 25
N° 5 3588801..3588873 73 N° 6 3588922..3588962 41 N° 7 3589012..3589064 53 N° 8 3589116..3589156 41
N° 9 3589207..3589329 123 N° 10 3589382..3589442 61 N° 11 3589498..3589676 179 N° 12 3589729..3589797 69
N° 13 3589848..3589954 107 N° 14 3590011..3590045 35 N° 15 3590097..3590130 34 N° 16 3590188..3590315 128
N° 17 3590364..3590467 104 N° 18 3590523..3590730 208  
join(3588106..3588316,3588379..3588451,3588509..3588569,3588717..3588741,3588801 ..3588873,3588922..3588962,3589012..3589064,3589116..3589156,3589207..3589329,35 89382..3589442,3589498..3589676,3589729..3589797,3589848..3589954,3590011..35900 45,3590097..3590130,3590188..3590315,3590364..3590467,3590523..3590730)


exon

Literature and cross-references PcarKat02
DNA ref. JGI genome:   scaffold_4 (3588106..3590730)
Protein sequence: PcarKat02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   541 (519)
PWM (Da):   %s   60300.13 (57930.8)  
PI (pH):   %s   6.28 (5.72) Peptide Signal:   %s   cut: 28 range:23-541
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARITLRRAFVSLVLVCAAARAQDAYTFDLNTGVDLQAATDAESAPQLTFATEAGVPYTHPYDAQKIGADGPLLLQDQHIIETLAHFVRERIPERVVHAKAAGAHGYFEVTNADFNGLKTPIVRISTVGGEMGSADTARDPRGFSVKFRTRKGIWDLVMNTPVFFIRDPTKFPHFIHTQKRDPQTHLRDDMYWDYLSSNPESLYQVMRLFSDLGTPDGVRHLNAWTGHSYRWIKADGSWVYVKLYCETMQGVQNLTNAEATAIAGSNPDYSQQDLFESIENSTYPGWIMYAQVLTPQQAETFKYNVLDLKDWGFDDVPKTEIGRFYLTQNPVNYFAEIEQAAFSPGRTVSGWEPSTDPVLQARVFSYDAQRYRLGVNYQLPVNAPTSPVANFQRDGHMALSNQGSRPNYLSTLQKINLPPLPYIEDTHQQWGGAVKSLSEVTAIDFDWPQRFWKSLSEQDQTNFISNVVGHLGTVNSVSVRQRQVALFALVDPALGKAIADGVNVTVPNPLPSFPTGPTWFNTTKPATNSTLNY

Retrieve as FASTA  
Remarks Complete sequence from genomic (17 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCCGCATCACTCTCCGACGCGCTTTCGTCTCACTTGTCCTGGTGTGCGCCGCCGCACGCGCCCAGGACGCGTACACCTTCGACCTGAACACCGGCGTCGACCTCCAGGCGGCGACG
GACGCAGAGTCTGCGCCGCAGCTCACGTTCGCGACCGAGGCCGGCGTGCCCTACACGCACCCGTACGACGCGCAGAAGATCGGCGCCGACG
GTGAGTCTCCTCATGGCTGTTGCTCGTCC
GCGCGCTTCTTCTCATGCGTCACGCTTGTGCAGGGCCTCTGCTCCTCCAGGACCAGCACATCATTGAGACTCTCGCCCATTTCGTGCGTGAGCGCATACCCGAGCGGTGAGCTTTGCGAG
CGAGCGGTCGTCCCTTCGACGTATGCTGACTTAGGGATCAAAGTGTCGTGCACGCGAAGGCGGCTGGCGCACATGGGTACTTTGAGGTCACGAATGCGGACTTTGTGAAGAATTACACAA
TCATGTGCGTGAAGCTTCTGGTGTGACTGCTCCTTTTATTTATCTAAACGCCCGATAGGGACGTATTTTCGGAGGTATGTATCGCAGTATCTGGTCTCTGGAAAGTACGGCAGAAGGTCT
AATCTTCGCAGAATGGCTTGAAAACCCCTATTACAGGTCTGTAGCTATTCATTTCCAATCGGGCCACCCTTGTTCATTTCGCTGTACTGTACTAGTCCGCATTAGCACCGTCGGTGGAGA
GATGGGCTCTGCGGACACAGCCAGAGACCCCCGTGGCTTTTCAGTGAA
GTGAGTTTGTTTAATAATAGTCTTGACGATGGTGCTCAAAAATGGTAGATTTCGGACGCGTAAGGGCATCTG
GGACTTGGTCATGAACA
GTAGGTCCAGACTACCTTCGTAAACTTGGTAAACGCTCACATATTGCAGACACACCCGTATTCTTTATCCGGGACCCCACGAAGTTCCCGCACTTCATCCACG
TTCGTGCCTCCCTTGTTTTGCGAAGTTTTAAAATGTTTATCCTCCAACAGACCCAGAAACGTGACCCGCAGACCCACTTGCGCGATCACGAGTATGTGCAAATTTCTCTGCCTGAGGCAT
AATACTGACGGGTCTTGGTAGCATGTATTGGGACTACCTGAGCTCGAACCCCGAGTCGCTCTACCAGGTGATGCGCCTGTTCTCGGACCTGGGCACGCCTGATGGTGTGCGGCACCTGAA
CGCGTGGACGGGCCATTCCTACAG
GTATAAAGCTATTTTCCTGTAATGTTAGCGCGCGTAGCTGATGTTGGTGCAGATGGATCAAGGCCGACGGCAGCTGGGTCTACGTCAAGCTGTACT
GCGAGACGATGCAGGGT
GTATGCGCGCCATTTTCCGTCGCCGCTAACAAGCCTCACTGACGTCCTCATGCAGGTCCAGAACTTAACTAACGCAGAGGCGACGGCCATCGCGGGCTCAAAC
CCGGACTACTCCCAACAGGACCTGTTCGAATCAATCGAGAACAGCACATACCCCGGCTGGATCATGTATGCGCAAGTACTGACACCACAGCAGGCCGAGACGTTCAAGTACAATGTCCTT
GACCTTACCAA
GTATGTAGCACTACCGTCTCTCCCAGTCGGGTGTGGTCTGACACACGACCAGGGACTGGGGCTTCGACGACGTGCCTAAGACCGAGATCGGCCGGTTCTACCTCACGCA
GAACCCAGTCAA
GTGGGTCTTCGTTTTTGATCCCGAGATCGGGTGCTGATACGATCTTACAGCTACTTTGCTGAGATCGAACAGGCGGCCTTCTCTCCTGGACGTACCGTCTCCGGATGG
GAGCCTTCGACGGATCCGGTGCTCCAAGCTCGTGTGTTCTCTTACGGGG
GTATGGAATCCGACGTTGGGTATATTAGAGATAAGCTGAAAAATCGCGCTCAACAGATGCACAGCGCTATC
GCCTTGGCGTGAACTATATG
GTAAGTAATTTCCCCGTGATTCAGGGCTTTCTGTTCAACATCTTGACGTAGCAACTGCCCGTCAATGCGCCAACGTCGCCTGTTGGTGCGTAGCTCTGCT
TCAGGATTACATTTATTGGCGGATGCTAACGGTTTATCGCAGCCAACTTCCAGCGTGATGGACACATGGCACTCAGCAATCAAGGCTCGCGTCCAAACTACTTGTCTACTCTGCAGAAGA
TCAATCTTCCACCTCTGCCGTACATCGAGGATACTCACCAACAATGGGCT
GTAAGTTGGGACAGCATCTCTGCTTTTCTTAGCTGACATGCAGCGCAGGGCGGTGCTGTCAAGTCCCTGT
CCGAGGTGACTGCCATCGATTTCGACTGGCCGCAGCGCTTCTGGAAGAGCCTTTCTGAGCAGGACCAGACGAACTTTATCAG
GTACGCACCCTCCCCGTACATACTTATACGGATTCTAG
CTGAGGCTCTTATTCAGCAACGTCGTTGGACACCTTGGCACAGTCAACAGCGTGTCTGTCCGGCAGCGCCAGGTCGCGCTCTTTGCGCTCGTCGACCCCGCGCTCGGCAAGGCCATTGCG
GATGGTGTCAACGTCACGGTGCCCAACCCCCTGCCAAGCTTCCCCACAGGGCCCACCTGGTTCAACACGACGAAGCCTGCGACCAACAGCACGCTGAACTATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCCGCATCACTCTCCGACGCGCTTTCGTCTCACTTGTCCTGGTGTGCGCCGCCGCACGCGCCCAGGACGCGTACACCTTCGACCTGAACACCGGCGTCGACCTCCAGGCGGCGACG
GACGCAGAGTCTGCGCCGCAGCTCACGTTCGCGACCGAGGCCGGCGTGCCCTACACGCACCCGTACGACGCGCAGAAGATCGGCGCCGACG
GGCCTCTGCTCCTCCAGGACCAGCACATC
ATTGAGACTCTCGCCCATTTCGTGCGTGAGCGCATACCCGAGCG
TGTCGTGCACGCGAAGGCGGCTGGCGCACATGGGTACTTTGAGGTCACGAATGCGGACTTTAATGGCTTGAAAACC
CCTATTACAG
TCCGCATTAGCACCGTCGGTGGAGAGATGGGCTCTGCGGACACAGCCAGAGACCCCCGTGGCTTTTCAGTGAAATTTCGGACGCGTAAGGGCATCTGGGACTTGGTCATG
AACA
ACACACCCGTATTCTTTATCCGGGACCCCACGAAGTTCCCGCACTTCATCCACACCCAGAAACGTGACCCGCAGACCCACTTGCGCGATCACGACATGTATTGGGACTACCTGAGC
TCGAACCCCGAGTCGCTCTACCAGGTGATGCGCCTGTTCTCGGACCTGGGCACGCCTGATGGTGTGCGGCACCTGAACGCGTGGACGGGCCATTCCTACAG
ATGGATCAAGGCCGACGGC
AGCTGGGTCTACGTCAAGCTGTACTGCGAGACGATGCAGGGT
GTCCAGAACTTAACTAACGCAGAGGCGACGGCCATCGCGGGCTCAAACCCGGACTACTCCCAACAGGACCTGTTCGAA
TCAATCGAGAACAGCACATACCCCGGCTGGATCATGTATGCGCAAGTACTGACACCACAGCAGGCCGAGACGTTCAAGTACAATGTCCTTGACCTTACCAA
GGACTGGGGCTTCGACGAC
GTGCCTAAGACCGAGATCGGCCGGTTCTACCTCACGCAGAACCCAGTCAA
CTACTTTGCTGAGATCGAACAGGCGGCCTTCTCTCCTGGACGTACCGTCTCCGGATGGGAGCCTTCGACG
GATCCGGTGCTCCAAGCTCGTGTGTTCTCTTACGGGG
ATGCACAGCGCTATCGCCTTGGCGTGAACTATATGCAACTGCCCGTCAATGCGCCAACGTCGCCTGTTGCCAACTTCCAGCGT
GATGGACACATGGCACTCAGCAATCAAGGCTCGCGTCCAAACTACTTGTCTACTCTGCAGAAGATCAATCTTCCACCTCTGCCGTACATCGAGGATACTCACCAACAATGGGCT
GGCGGT
GCTGTCAAGTCCCTGTCCGAGGTGACTGCCATCGATTTCGACTGGCCGCAGCGCTTCTGGAAGAGCCTTTCTGAGCAGGACCAGACGAACTTTATCAG
CAACGTCGTTGGACACCTTGGC
ACAGTCAACAGCGTGTCTGTCCGGCAGCGCCAGGTCGCGCTCTTTGCGCTCGTCGACCCCGCGCTCGGCAAGGCCATTGCGGATGGTGTCAACGTCACGGTGCCCAACCCCCTGCCAAGC
TTCCCCACAGGGCCCACCTGGTTCAACACGACGAAGCCTGCGACCAACAGCACGCTGAACTATTAG

Retrieve as FASTA