Entry information : PcarHalPrx04
Entry ID 9929
Creation 0000-00-00 (Christophe Dunand)
Last sequence changes 2011-12-14 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-12-14 (Christophe Dunand)
Peroxidase information: PcarHalPrx04
Name PcarHalPrx04
Class Haloperoxidase (haem)    [Orthogroup: HalPrx001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phanerochaete
Organism Phanerochaete carnosa    [TaxId: 231932 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PcarHalPrx04
start..stop
S start..stop
PcHalPrx02 390 7e-137 7..256 24..273
PcHalPrx03 343 4e-120 3..262 20..278
PplHalPrx04 264 3e-87 3..258 17..275
AbHalPrx02_bisporus 173 1e-53 7..253 33..260
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3016452..3016480 29 N° 2 3015108..3015870 763  
complement(join(3015108..3015870,3016452..3016480))


exon

Literature and cross-references PcarHalPrx04
DNA ref. JGI genome:   scaffold_2 (3016480..3015108)
Protein sequence: PcarHalPrx04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   263
PWM (Da):   %s   29340.1  
PI (pH):   %s   7.45
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSSGSHAFCPPMEGDSRSPCPAVNTLANHGYLPRDGKSITPALLIDALTQCYRLSKPLAWILAYGGLLLLGQGLGPFELHDLARHNKIEHDASLFHPNIGPREEYAPIHGEAQLLRAFLAMSADGRVITPEDLARIRVQREAETPLDPLHAEIARGEMAIVFNMFNNPDPTLHEAGVPLQPRRSIFRLVHTLLHRPDTGASRPLDGVPIDRLRYWFEHERIPPGWEPYHETTLLDTVATSMRIRRAMKITREVASERRGRSH

Retrieve as FASTA  
Remarks Complete sequence from genomic. No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCAGCTCGGGATCTCACGCTTTCTGCCCGCCAATGGAAGGCGACAGTCGCTCACCTTGTCCGGCGGTGAACACGCTGGCAAACCACGGCTACCTCCCGCGCGACGGGAAATCTATC
ACACCAGCCCTCCTCATCGATGCCCTTACGCAGTGCTACCGACTCTCGAAGCCCCTCGCCTGGATACTGGCCTATGGTGGACTCCTCCTCCTCGGCCAAGGCTTAGGACCGTTCGAATTG
CACGACCTCGCGCGGCACAACAAAATCGAGCACGACGCCAGTCTCTTTCATCCGAATATCGGCCCACGCGAAGAGTACGCCCCGATCCATGGCGAAGCGCAGCTGCTGAGGGCCTTTCTC
GCGATGTCTGCGGATGGGCGCGTCATAACTCCCGAGGATCTCGCGCGTATACGGGTGCAGCGCGAAGCAGAGACGCCGCTGGATCCCCTGCACGCCGAGATCGCACGTGGAGAGATGGCG
ATCGTGTTCAACATGTTCAACAACCCGGACCCGACGCTCCATGAGGCGGGCGTACCGCTGCAACCTCGCAGATCGATTTTTCGCCTCGTACACACGCTACTCCATCGTCCAGACACCGGC
GCAAGCCGCCCGCTCGATGGTGTTCCTATCGATCGGCTGCGCTACTGGTTTGAGCATGAGCGAATCCCGCCCGGCTGGGAGCCCTATCACGAGACGACGCTACTCGATACCGTGGCAACC
AGCATGCGAATTCGGAGGGCGATGAAGATCACGCGAGAGGTGGGTATTGCCCAGACCCATAAGACGAAGGGGGCGGTTCAGGAGGAGCTCGAGCGGATGCTCCAGTCTCAAGGAGACGGT
GCCGCCATGGAGTCAGGCAGTAGCGGACAAGCTTCGAGCATCGAGATGCGAGTTCTCGCTACACGGAGAACGCATGAGCGCGGTATGCATGGGTAACGCGAGAAATGACAAGGACTTCCA
ATGGCTGCTCTAGTACAATGATGTCGTCTGGCAGCGTATGGGCCCAGTTTTCATAATTTATCTGTATTCTGAGTCTTGTGTCCTGTGTATCTAAGAGTGCAACTACATACTGTATGAACT
GGCTTCAAGTAAATACTGTTCACCGGCTAGAGTGTCCTCCCGTCGACGTCACCTCCGCGAGCTCGTGGCGCGTCACGTGCGATATTGATGTGAGACTCGAAGGACATCTGTTGCACTTGA
CCCTCGCCGTTGACGAGCGTGGTCTCTTTGCAAGCTCTCCATATGTTGCAAAGCCGTTGGAAGTGGCTGCTGACTGTCGCGGCTTTTGCTGGCGCCTCAAAAAGTGTGTATGCACGAGGT
CTGCCGCCAGAGGCGTTTCGGCAGCCAGCGAGCGACGCGGTAGATCACATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCAGCTCGGGATCTCACGCTTTCTGCGCTCGATGGTGTTCCTATCGATCGGCTGCGCTACTGGTTTGAGCATGAGCGAATCCCGCCCGGCTGGGAGCCCTATCACGAGACGACGCT
ACTCGATACCGTGGCAACCAGCATGCGAATTCGGAGGGCGATGAAGATCACGCGAGAGGTGGGTATTGCCCAGACCCATAAGACGAAGGGGGCGGTTCAGGAGGAGCTCGAGCGGATGCT
CCAGTCTCAAGGAGACGGTGCCGCCATGGAGTCAGGCAGTAGCGGACAAGCTTCGAGCATCGAGATGCGAGTTCTCGCTACACGGAGAACGCATGAGCGCGGTATGCATGGGTAACGCGA
GAAATGACAAGGACTTCCAATGGCTGCTCTAGTACAATGATGTCGTCTGGCAGCGTATGGGCCCAGTTTTCATAATTTATCTGTATTCTGAGTCTTGTGTCCTGTGTATCTAAGAGTGCA
ACTACATACTGTATGAACTGGCTTCAAGTAAATACTGTTCACCGGCTAGAGTGTCCTCCCGTCGACGTCACCTCCGCGAGCTCGTGGCGCGTCACGTGCGATATTGATGTGAGACTCGAA
GGACATCTGTTGCACTTGACCCTCGCCGTTGACGAGCGTGGTCTCTTTGCAAGCTCTCCATATGTTGCAAAGCCGTTGGAAGTGGCTGCTGACTGTCGCGGCTTTTGCTGGCGCCTCAAA
AAGTGTGTATGCACGAGGTCTGCCGCCAGAGGCGTTTCGGCAGCCAGCGAGCGACGCGGTAGATCACATTGA

Retrieve as FASTA