Entry information : SiPrx174
Entry ID 9936
Creation 2011-11-25 (Qiang LI)
Last sequence changes 2012-04-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-27 (Christophe Dunand)
Peroxidase information: SiPrx174
Name SiPrx174
Class Class III peroxidase     [Orthogroup: Prx203]*
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx174
start..stop
S start..stop
SiPrx132 388 1e-136 1..314 1..310
TaPrx113-1A 368 1e-128 1..314 1..311
AvePrx113-1A 368 1e-128 1..314 1..311
HvPrx08 367 2e-128 1..314 1..311
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 48194821..48195075 255 N° 2 48195223..48195363 141 N° 3 48195473..48196021 549  
join(48194821..48195075,48195223..48195363,48195473..48196021)


exon

Literature and cross-references SiPrx174
DNA ref. Phytozome 12:   scaffold_2 (48194821..48196020)
Protein sequence: SiPrx174
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   314 (292)
PWM (Da):   %s   33172.68 (31155.7)  
PI (pH):   %s   8.41 (8.48) Peptide Signal:   %s   cut: 23 range:23-314
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASASSCLSLLLVVAPASSASAQLSSTLYDTPCPRALATIRSAVNAAVAQEARMGASLLRLHFHDCFVQVCVHYFLLFQEFTVFGERTVAPNLSLRGYEVIDKIKAQVEAICKQTVSCADILAVAARDSVVALGGPSWTVLLGRRDSTTAADMNTVLNSLPPPSCSLAQLIREYGNLGLNPTDMAALSGAHTIGLAHCRTTGLTPYTYNDANIDPTFARSLRANCPMANNTGGDVTAPLDTTTPARFDNAYYRNLLSRKGLLHSSFSTDNTVRSFASNPSAFSSAFAAAMVKMGNISPKTGSQGQIRLTCSKVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. No prediction from phytozome. join(48194821..48195075,48195223..48195363,48195473..48196020)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTGCTTCATCATGCCTTAGCTTGTTGCTGGTCGTGGCACCGGCCTCGTCGGCGTCGGCGCAGCTGTCTTCGACGTTATACGACACGCCGTGCCCGAGGGCTCTGGCCACCATC
AGGAGCGCCGTGAACGCCGCGGTGGCGCAGGAGGCTCGCATGGGGGCGTCGCTGCTCAGGCTGCACTTCCACGACTGCTTTGTCCAAGTATGCGTCCATTATTTTCTTCTGTTTCAAGAG
TTCACGGTTTTTGGA
GTTGACAGCCATTTTAAAACCAAACTACACTAATAGACTTCAGCGTCATAATATATTGATCAAGGACTTGCCGACTAAATGACATGCCCTCTTTGTCCCTTTGAC
TCCGGCCAGGGCTGCGACGCATCCGTTCTACTGGCGGGGAACGAGCGGACCGTTGCTCCGAATCTATCTCTCAGAGGCTACGAGGTCATCGACAAGATCAAGGCGCAGGTGGAGGCCATC
TGCAAGCAGACCGTCTCGTGCGCTGACATCCTCGCCGTCGCCGCCCGTGACTCCGTCGTAGCG
GTAAGACACTGCGCGTGGCGTGACGACAGGCAACGCAACACGAGGCCCTGCTACAAG
TTAGTGAATCCCACCAGCATTCATTCGGTAGTTTTGACTGTACGTTTGACAGCTCGGAGGGCCGTCATGGACTGTTCTGCTGGGGAGAAGGGACTCGACCACCGCTGCAGACATGAACAC
GGTGTTGAACAGCCTCCCTCCGCCTTCATGTAGCCTCGCGCAACTGATTAGAGAGTACGGCAACCTGGGACTCAACCCAACCGACATGGCTGCTCTCTCAGGTGCACACACGATCGGTCT
GGCGCACTGCCGAACTACAGGGCTCACACCATACACCTACAACGACGCCAACATAGACCCGACGTTCGCCAGGTCGCTCAGGGCCAACTGCCCCATGGCAAACAACACCGGCGGGGACGT
TACGGCGCCGCTGGACACGACGACGCCCGCAAGGTTCGACAACGCCTACTACAGGAACCTGCTGTCGCGGAAGGGGCTCCTGCACTCGTCGTTCAGCACCGACAACACTGTCCGGAGCTT
CGCGTCCAACCCGTCGGCGTTCAGCAGCGCCTTCGCGGCGGCGATGGTGAAGATGGGGAACATCAGCCCCAAGACGGGGAGCCAGGGCCAGATCAGGCTCACCTGCTCCAAGGTGAACTA
G

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTGCTTCATCATGCCTTAGCTTGTTGCTGGTCGTGGCACCGGCCTCGTCGGCGTCGGCGCAGCTGTCTTCGACGTTATACGACACGCCGTGCCCGAGGGCTCTGGCCACCATC
AGGAGCGCCGTGAACGCCGCGGTGGCGCAGGAGGCTCGCATGGGGGCGTCGCTGCTCAGGCTGCACTTCCACGACTGCTTTGTCCAAGTATGCGTCCATTATTTTCTTCTGTTTCAAGAG
TTCACGGTTTTTGGA
GAGCGGACCGTTGCTCCGAATCTATCTCTCAGAGGCTACGAGGTCATCGACAAGATCAAGGCGCAGGTGGAGGCCATCTGCAAGCAGACCGTCTCGTGCGCTGAC
ATCCTCGCCGTCGCCGCCCGTGACTCCGTCGTAGCG
CTCGGAGGGCCGTCATGGACTGTTCTGCTGGGGAGAAGGGACTCGACCACCGCTGCAGACATGAACACGGTGTTGAACAGCCTC
CCTCCGCCTTCATGTAGCCTCGCGCAACTGATTAGAGAGTACGGCAACCTGGGACTCAACCCAACCGACATGGCTGCTCTCTCAGGTGCACACACGATCGGTCTGGCGCACTGCCGAACT
ACAGGGCTCACACCATACACCTACAACGACGCCAACATAGACCCGACGTTCGCCAGGTCGCTCAGGGCCAACTGCCCCATGGCAAACAACACCGGCGGGGACGTTACGGCGCCGCTGGAC
ACGACGACGCCCGCAAGGTTCGACAACGCCTACTACAGGAACCTGCTGTCGCGGAAGGGGCTCCTGCACTCGTCGTTCAGCACCGACAACACTGTCCGGAGCTTCGCGTCCAACCCGTCG
GCGTTCAGCAGCGCCTTCGCGGCGGCGATGGTGAAGATGGGGAACATCAGCCCCAAGACGGGGAGCCAGGGCCAGATCAGGCTCACCTGCTCCAAGGTGAACTAG

Retrieve as FASTA