Entry information : ZmAPx05 (APx1 / GRMZM2G054300 [6a])
Entry ID 995
Creation 2008-10-03 (Christophe Dunand)
Last sequence changes 2008-10-03 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-07-07 (Christophe Dunand)
Peroxidase information: ZmAPx05 (APx1 / GRMZM2G054300 [6a])
Name (synonym) ZmAPx05 (APx1 / GRMZM2G054300 [6a])
Class Ascorbate peroxidase    [Orthogroup: APx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation Cytosolic
Tissue type Leaves
Inducer Bacterium infection
Repressor N/D
Best BLASTp hits
Perox score E-value ZmAPx05
start..stop
S start..stop
ZmAPx01 499 0 1..250 1..250
SbAPx01 494 2e-180 1..250 1..250
SiAPx01 487 1e-177 1..250 1..250
PamAPx01 483 2e-176 1..250 1..250
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 138424624..138424742 119 N° 2 138424850..138425024 175 N° 3 138425134..138425199 66 N° 4 138426843..138426891 49
N° 5 138427132..138427217 86 N° 6 138427301..138427380 80 N° 7 138427538..138427640 103 N° 8 138427717..138427775 59
N° 9 138427851..138427866 16  
join(138424624..138424742,138424850..138425024,138425134..138425199,138426843..1 38426891,138427132..138427217,138427301..138427380,138427538..138427640,13842771 7..138427775,138427851..138427866)


exon

Literature and cross-references ZmAPx05 (APx1 / GRMZM2G054300 [6a])
Literature REFERENCE 1 Bai,J. et al., Comparison of pathogen induced defense gene profiles on maize lines with different resistance genes. Unpublished (2003).
REFERENCE 2 Lai,J., Dey,N., Kim,C.S., Bharti,A.K., Rudd,S., Mayer,K.F., Larkins,B.A., Becraft,P. and Messing,J. Characterization of the maize endosperm transcriptome and its comparison to the rice genome. Genome Res. 14 (10A), 1932-1937 (2004).
REFERENCE 3 Wilson,R.K., Higginbotham,J., Marchetto,P. and Ochoa,K. The sequence of Zea mays bac clone ZMMBBb-125N17.
Protein ref. UniProtKB:   B6TM55
DNA ref. GenBank:   AC202833.3 (78616..81860)
mRNA ref. GenBank:   EU966070
Cluster/Prediction ref. UniGene:   Zm.20035
Protein sequence: ZmAPx05 (APx1 / GRMZM2G054300 [6a])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   250
PWM (Da):   %s   27219.78  
PI (pH):   %s   5.91
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAKNYPTVSAEYSEAVEKARRKLRALIAEKSCAPLMLRLAWHSAGTFDVSSRTGGPFGTMKCPAELAHGANAGLDIAVRLLEPIKEEFPTLSYADFYLAGVVAVEVTGGPEIPFHPGREDKPQPPPEGRLPDATKGSDHLRQVFGKQMGLSDQDIVALSGGHTGRCHKERSGFEGAWTTNPLVFDNSYFKELLSGDKEGLLQLPSDKALLSDPVFRPLVEKYADEKAFFDDYKEAHLKLSELGYADA

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 9, 8 introns), 1 mRNA and 460 ESTs. ALso found in AC220062.3.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAAGAATTACCCAACCGTGAGCGCCGAGTACAGCGAGGCCGTCGAGAAGGCCAGGCGCAAGCTCCGCGCCCTCATCGCCGAGAAGAGCTGCGCGCCCCTCATGCTCCGCCTCGCG
TAAGCCTTCCCTCCCCCGCGCGCGCATTTCCAGATCTTTGTGGGGGGGGGGGGGGGGGGGGAGCCTTTTCGGTTGCCTGATCTGCAGCTCACGTTTAATCGCGCAGGTGGCACTCCGCGG
GGACGTTCGACGTGTCGTCGAGGACCGGCGGTCCCTTCGGTACTATGAAGTGCCCGGCGGAACTGGCTCACGGCGCCAACGCGGGGCTGGACATCGCGGTGCGGCTGCTCGAGCCCATCA
AGGAGGAGTTCCCCACCCTCTCCTATGCCGATTTCTACCAG
GTCGGCCCCTGATCTCGCATCGATCTGGTTGGATGATTCGATCTGCCCGAATCGATGTGCGTTTTGACCGTGTCCCTTG
CTCCCTTTCTCTCTCTGCTCTTCTTTGCAGCTTGCCGGAGTTGTGGCCGTCGAGGTCACCGGTGGGCCTGAGATCCCCTTCCACCCCGGCAGGGAGGTGAGATTTTTCATCCATTTCTCA
CTATCTTTGGGGTTTAGGCAGGGTTTAAGTTCTTGTTTCGAAATCTCCGAGGGGGTTGGTGTGAAGGTCGTTCAGTGAGATCGTGGTTGTTTACTCCAACTAGCGATAACTCTCATCTGT
TTGTTTTTTTGTCATCTGTTTGGGACATATCCATGCAATCAAATCATCCTGAGCATCAAATCTAGATCCAATGTTTTCATATGGAAGGGATTAAATATAAAATAGATACCATTTCAGATG
AAAAGGGTTAAATGTAAAATAATCGTCACTGTTGGATTTTGATTGAATAACCAGATCACTTGATTACATGCTTACACCATCATGATTGATTGCACAGGATATGTTTCCGTAGATACCTCC
CACAGTCAGCGATAACAATTTATTCCTGACACGTGATTTTATTTCTTCACGTAACCTTTATTTTCCTTTGACATTTTTTTGAGGCTTGTGTCCACACATCTTTCTGGTCTGTGGGTTCAT
TGTTTCGTGTTGACATGGACACCAGTTTATGTTTTGATTATATTGTAGTTATAGATATTATCTTTGAATGGTGGGCATTATGCTGCAAAAGCAATTTAGCGGTTTAATCTGATGTTCATC
AATATTTGAGATGCAGTTTCCTTGTTGGTACTCATTAATTCCTCGTCTCTTGAAGACGTGATAGGAAAGTCACATCAGTAACTTTATTGCTTGTTTCATACTTTTTAGTATGGGAAAGGA
TGCCACTAATAACTAGGTATCAAAATTATGTTGTTAGAAGCTGTCTCTAACATTATGGTTCCATCTGTATTGGTTTGCAATTCGAGAGTATTCATATAACCTTTTGCAAATTAATGTTGA
AATGCTGGATTTATCACGGATATGGAAAATTAATCTGTTGTTTTGTCATTTTGTATTGTTCTACATCCAACTTTTTTTATTGCTTTGAATGATGATATATTCAATTATTTTGCAATACTG
TTTAATTCTTGTCATCTTGTGTATATATTATGTTGAGTTGGTAGGTCATGTGATGAGGTATAATATAATTGTGCCCTTATCCTGTTATACATTTATATGTTGGCCAATACAATACCATAT
CTTAGGTCTTTGTATCTTTATTGGGGAGGTCCACTTCTCTTCTTGGATGCACTGAACATTCCAGAGTATGCTATTGGGTATGAGTTGTATGGTTGAGTCGAGGCTTTTCATGCCGTCTAG
ATGATGAGGTGCATGATGTAGATTATGCACACGTATAGTTCCAGTTGATATGTTGTCAAATTATACACACATAGACCATAAACTTTCTGCATGGTGTCCAGAGCTGATAATATTTTCCCT
TGATTTGTTGTTACTATGTGTTGGGTGACAATTAGTTAACCTTTGGTGATAAAGTTGCTCGATTCTATCTCTTCTCTTTTCTAATAACTATAGAGAAACATGACTGAGAAGGGTAGACCT
TTGCAGTGGTGAGAACTGAGTCAGGGGAAGGCTTGCTCGGTTTATCCCTTCCGCACCCTACTCATGTGGGAGTCTACTGCACTGGATCTTTTCTTTTTATAGACATGACTGAGTGATGAT
GTTATTTGTTCCATGCCTTTTTCGTCATCAGTATTTATATCTTTCCTTGTCTTTTTCAGGACAAGCCTCAGCCGCCACCTGAGGGCCGTCTTCCTGATGCCACCAAGGGTAGATTTCTAA
TCTTTACTAGATTGGCATGAATGCTGAGTTAATGGGTTACATTGACCTTGCATCTTTTTTTAAGTGTTTCAAAGATGTTGTTTTGGCATCCCTGTACCCAGCTTGCTTTGGGTAACAGTG
GTTCCTTGTAGCCAAGGCACCGCATAGGCGGCCAGACCAAACACTCGTTTTCATGTCACTTCTATTGACACGAGGACTGGCACTTGCTGCTTGCTTTTTTTTAACCAGGTTCTGACCACC
TGAGGCAAGTCTTTGGCAAGCAGATGGGTTTGAGTGATCAGGACATTGTTGCCCTCTCTGGTGGCCACACCTTG
GTTTGTTGCTGTCCACTCATGTTTGCTTCAGGAATTTAATGTGTAT
GCCTGTACTGATTTAGTTTTCTTTGAGGTTTTATTAGGGAAGGTGCCACAAAGAGCGGTCTGGTTTTGAGGGGGCCTGGACTACGAACCCTTTGGTCTTTGACAACTCTTACTTCAAGTG
AGTGTATGTCTTGTTTACTATTGAAAAGCAACTGCATTTAGTTAAGAAATACTTAAAATTTGTTTACCTTTGTTATGTCATTACTGGGCAGCTGAATGCTGTGCTAGAAATTAACAGCCA
TCCCATATATCCTACTATTCCCATATTTTCATAGGGAACTTCTGAGTGGCGACAAGGAGGGCCTTCTTCAGCTCCCAAGTGACAAAGCCCTGCTGAGCGACCCTGTCTTCCGCCCTCTTG
TGGAGAAATATGCTGCA
GTATGTCCTTGGTCATTATTATCCAGGGTATGGAGATTCATAGGGAGGCAAGTACTGATTATCGTGTGCTCTGTAGGATGAGAAGGCATTCTTTGATGACTAC
AAAGAGGCCCACCTCAAGCTCTCCGAACTGGG
GTGAGTAACCATTGGTTGCACAATGTGTGATTGGTCAGTGGAACAAATCTGATCGTTTACTCTTCTGGGGTGCAGGTATGCTGATGCT
TAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAAGAATTACCCAACCGTGAGCGCCGAGTACAGCGAGGCCGTCGAGAAGGCCAGGCGCAAGCTCCGCGCCCTCATCGCCGAGAAGAGCTGCGCGCCCCTCATGCTCCGCCTCGCG
TGGCACTCCGCGGGGACGTTCGACGTGTCGTCGAGGACCGGCGGTCCCTTCGGTACTATGAAGTGCCCGGCGGAACTGGCTCACGGCGCCAACGCGGGGCTGGACATCGCGGTGCGGCTG
CTCGAGCCCATCAAGGAGGAGTTCCCCACCCTCTCCTATGCCGATTTCTACCAG
CTTGCCGGAGTTGTGGCCGTCGAGGTCACCGGTGGGCCTGAGATCCCCTTCCACCCCGGCAGGGAG
GACAAGCCTCAGCCGCCACCTGAGGGCCGTCTTCCTGATGCCACCAAGGGTTCTGACCACCTGAGGCAAGTCTTTGGCAAGCAGATGGGTTTGAGTGATCAGGACATTGTTGCCCTCTCT
GGTGGCCACACCTTG
GGAAGGTGCCACAAAGAGCGGTCTGGTTTTGAGGGGGCCTGGACTACGAACCCTTTGGTCTTTGACAACTCTTACTTCAAGGAACTTCTGAGTGGCGACAAGGAG
GGCCTTCTTCAGCTCCCAAGTGACAAAGCCCTGCTGAGCGACCCTGTCTTCCGCCCTCTTGTGGAGAAATATGCTGCA
GATGAGAAGGCATTCTTTGATGACTACAAAGAGGCCCACCTC
AAGCTCTCCGAACTGGG
GTATGCTGATGCTTAA

Retrieve as FASTA