Entry information : PcarKat04
Entry ID 9958
Creation 2011-12-14 (Christophe Dunand)
Last sequence changes 2011-12-14 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-04-06 (Catherine Mathe (Scipio))
Peroxidase information: PcarKat04
Name PcarKat04
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phanerochaete
Organism Phanerochaete carnosa    [TaxId: 231932 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PcarKat04
start..stop
S start..stop
PcKat04 1367 0 1..742 1..740
PcKat05 1342 0 1..742 1..739
PcarKat05 1342 0 1..742 1..740
PplKat04 1201 0 2..742 4..745
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 977..1119 143 N° 2 1174..1271 98 N° 3 1324..1484 161 N° 4 1542..1620 79
N° 5 1674..2012 339 N° 6 2064..2553 490 N° 7 2616..3283 668 N° 8 3336..3586 251
join(977..1119,1174..1271,1324..1484,1542..1620,1674..2012,2064..2553,2616..3283 ,3336..3586)


exon

Literature and cross-references PcarKat04
DNA ref. JGI genome:   scaffold_386 (977..3586)
Protein sequence: PcarKat04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   742
PWM (Da):   %s   83669.2  
PI (pH):   %s   6.54
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSLTAALKEKVTAVAETKKIADLQRDIIKQENYLTSDLGVKVSDTDNWLKVSDGKTSGPSLLEDHIAREKIHRFDHERIERVVHARGAGAHGYFKVHNDVAKKYTFAPVLTDPSRTTPTFVRFSTVQGSRGSDTVRDVRGFAVKFYTEEGNWDIVGNDIPVFFIQDAMKFPDIVHAVKPEPHNEVPTGQSAHNNFWDFAGLQPESAHMIMWVMSDRGIPRSYRMMQGFGVNTYTLINEKGERFFVKFHWLPELGVHSFVWDEALKICGQDPDFHRKDLEEAITNGAFPKWHFGIQAIPEAREHDFDFDILDATKVWPEELVPLEIVGEMVLNRTVDEYFPEVEQVAFCTSHVVPGIGFSDDPLLQGRNFSYFDTQVSRLGINWQELPINRPVCPVMNYQRDGKMRHKIHQGTINYWPNRAEQFRPVSPKDGGYAEYPEGVAGMKARMRGEKFKEHFNHAQLFYNSLAEYERQHLINAISFELSHCDDPVVYESYIKVLHNVDLNLAKQVKINVGGSDVDSKEPARDNHGKSTPTLSQLYYAPKEPTIKSRRIAILVADGFDLAQVEGLRAAIKAGMATSWIIGPRRGWIYPEDVDVGSKMRGVWADHHFEGQRSTLFDAFIVPDGRKSAETLAENGRTIHWIREAFGHCKAIGAIGGVSFLREAVMLPGIEYNTKLDSDEVVTSFGVVTVGKVSTSTLAADTLKIAEGEKNFVSTFAYEVSKHRCYERELKGLTKKVAY

Retrieve as FASTA  
Remarks complete sequence from genomic (7 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGTTTGACCGCAGCTCTCAAGGAGAAGGTCACCGCCGTAGCGGAGACGAAGAAGATTGCGGACCTGCAGAGGGACATCATCAAGCAGGAGAATTACCTGACCAGCGACCTCGGGGTC
AAGGTGTCGGACACTGATAATTG
GTGGATAGCTTCCGCGTCGCTTCACGTTGCCGCTTTCTGACTGCGTTTCGCCAGGCTCAAAGTCTCGGATGGGAAGACATCTGGTCCGTCGCTACTC
GAGGACCACATTGCACGCGAGAAAATCCACCGCTTCGACCACGAGCGCATTCCAG
GTACGTCAGTCGGCAACCCCAGCACCATACGCATTACTGACCGGCGACGCAGAGCGCGTGGTCCA
TGCACGTGGTGCTGGCGCACACGGCTATTTCAAGGTCCACAATGATGTCGCGAAGAAGTATACCTTCGCTCCCGTCTTAACCGACCCCTCGCGCACTACTCCCACCTTCGTCCGCTTCAG
CACCGTGCAGGGCTCAAGGGGGAGTGCT
GTGAGTATTCTTGCGTCTCTGCTGTTTTCCGTATGCTCTAATTCAAATGTTTCTCAGGACACCGTCAGAGACGTTAGAGGCTTCGCCGTCAA
GTTCTATACTGAAGAGGGCAACTGGGACATTGTCGGTAACGACA
GTCAGTAAAAACCCTTTCTAATCCATCTAGATCGTTGCTAATCCTCAACGTAGTTCCTGTCTTTTTCATTCAAGAT
GCCATGAAGTTCCCTGATATTGTTCACGCCGTCAAACCTGAGCCTCACAACGAAGTTCCGACTGGACAGAGCGCCCACAACAACTTCTGGGACTTTGCTGGCTTGCAACCCGAATCTGCT
CACATGATCATGTGGGTCATGTCCGACCGTGGCATCCCTCGTTCGTACAGGATGATGCAGGGCTTTGGTGTCAACACCTATACTCTTATTAACGAAAAGGGTGAACGCTTCTTCGTCAAG
TTCCACTGGCTACCGGAGCTTGGTGTTCACAGTTTCGTTTGGGATGAGGCGTTGAAGATCTGCGGCCAGGACCCTG
GTAGGTCGCTCTCGTGAACAACACGCATCACCTGCTCATCATCT
CTCTTAGACTTCCACCGCAAGGACCTCGAGGAGGCGATTACCAACGGTGCCTTCCCCAAGTGGCACTTCGGGATCCAAGCCATCCCTGAGGCACGTGAGCACGACTTCGACTTCGACATC
CTTGACGCAACCAAGGTCTGGCCAGAGGAGCTTGTGCCTCTCGAGATCGTTGGAGAGATGGTTCTCAATCGCACCGTCGACGAATACTTCCCAGAGGTCGAGCAGGTTGCCTTCTGCACA
TCCCACGTTGTCCCTGGCATCGGCTTCAGCGACGACCCCCTTCTGCAAGGCCGCAACTTCTCTTATTTCGACACCCAGGTCTCTCGACTCGGCATCAACTGGCAAGAACTGCCGATCAAC
AGGCCAGTTTGCCCCGTCATGAACTACCAGCGGGATGGCAAGATGAGGCACAAGATCCATCAGGGCACCATCAACTACTGGCCTAACCGCGCCGAACAGTTCAGGCCTGTATCTCCCAAA
GATGGTGGTTATGCCGA
GTACGTCTAGACATGTCGCTCAGACGGATCCTATGGGTATCTAACTAAACTCTAATCCCCAGGTATCCTGAAGGGGTCGCCGGCATGAAGGCTCGCATGCGCG
GCGAAAAGTTTAAGGAGCATTTCAACCATGCGCAGCTGTTCTACAATTCACTCGCCGAGTATGAGAGACAGCATCTCATCAACGCGATTTCGTTCGAGCTTTCGCACTGCGACGACCCAG
TAGTTTATGAATCGTACATCAAGGTGCTCCACAACGTCGACCTCAACCTCGCAAAACAGGTCAAGATTAACGTCGGCGGCTCTGATGTCGACTCTAAGGAGCCCGCGCGCGATAATCATG
GAAAATCGACGCCGACATTGTCGCAGCTGTATTACGCACCAAAGGAGCCTACTATCAAGTCACGCCGCATCGCGATCCTTGTCGCCGACGGCTTCGACCTCGCACAAGTTGAGGGTCTAC
GCGCCGCCATCAAAGCGGGTATGGCGACCTCCTGGATCATTGGCCCTCGCCGCGGCTGGATATATCCCGAAGATGTCGATGTTGGCTCCAAGATGCGCGGCGTGTGGGCAGATCATCACT
TCGAGGGACAACGCAGCACGCTGTTCGACGCGTTCATCGTTCCTGATGGACGCAAGAGTGCTGAGACGCTTGCTGAGAATGGTCGTACCATTCACTGGATCCGGGAGGCGTTTGGCCATT
GCAAGGCTATTGGTGCTATTGGCGAAG
GTACGCATCCGCATCAGCTTTCGATGGTCTAGTGTGCTTACTTGCTCACCAGGTGTCTCCTTTTTACGCGAGGCCGTCATGCTCCCAGGTATC
GAGTACAATACGAAATTGGACAGCGACGAAGTTGTCACCTCGTTCGGCGTCGTCACCGTCGGCAAAGTCAGCACCTCTACACTCGCTGCGGACACCCTCAAAATTGCCGAAGGCGAGAAG
AACTTCGTGTCCACGTTTGCGTACGAGGTCAGCAAGCACCGGTGCTACGAGCGCGAGCTCAAGGGCTTAACCAAGAAGGTTGCGTATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGTTTGACCGCAGCTCTCAAGGAGAAGGTCACCGCCGTAGCGGAGACGAAGAAGATTGCGGACCTGCAGAGGGACATCATCAAGCAGGAGAATTACCTGACCAGCGACCTCGGGGTC
AAGGTGTCGGACACTGATAATTG
GCTCAAAGTCTCGGATGGGAAGACATCTGGTCCGTCGCTACTCGAGGACCACATTGCACGCGAGAAAATCCACCGCTTCGACCACGAGCGCATTCCA
G
AGCGCGTGGTCCATGCACGTGGTGCTGGCGCACACGGCTATTTCAAGGTCCACAATGATGTCGCGAAGAAGTATACCTTCGCTCCCGTCTTAACCGACCCCTCGCGCACTACTCCCACC
TTCGTCCGCTTCAGCACCGTGCAGGGCTCAAGGGGGAGTGCT
GACACCGTCAGAGACGTTAGAGGCTTCGCCGTCAAGTTCTATACTGAAGAGGGCAACTGGGACATTGTCGGTAACGAC
A
TTCCTGTCTTTTTCATTCAAGATGCCATGAAGTTCCCTGATATTGTTCACGCCGTCAAACCTGAGCCTCACAACGAAGTTCCGACTGGACAGAGCGCCCACAACAACTTCTGGGACTTT
GCTGGCTTGCAACCCGAATCTGCTCACATGATCATGTGGGTCATGTCCGACCGTGGCATCCCTCGTTCGTACAGGATGATGCAGGGCTTTGGTGTCAACACCTATACTCTTATTAACGAA
AAGGGTGAACGCTTCTTCGTCAAGTTCCACTGGCTACCGGAGCTTGGTGTTCACAGTTTCGTTTGGGATGAGGCGTTGAAGATCTGCGGCCAGGACCCTG
ACTTCCACCGCAAGGACCTC
GAGGAGGCGATTACCAACGGTGCCTTCCCCAAGTGGCACTTCGGGATCCAAGCCATCCCTGAGGCACGTGAGCACGACTTCGACTTCGACATCCTTGACGCAACCAAGGTCTGGCCAGAG
GAGCTTGTGCCTCTCGAGATCGTTGGAGAGATGGTTCTCAATCGCACCGTCGACGAATACTTCCCAGAGGTCGAGCAGGTTGCCTTCTGCACATCCCACGTTGTCCCTGGCATCGGCTTC
AGCGACGACCCCCTTCTGCAAGGCCGCAACTTCTCTTATTTCGACACCCAGGTCTCTCGACTCGGCATCAACTGGCAAGAACTGCCGATCAACAGGCCAGTTTGCCCCGTCATGAACTAC
CAGCGGGATGGCAAGATGAGGCACAAGATCCATCAGGGCACCATCAACTACTGGCCTAACCGCGCCGAACAGTTCAGGCCTGTATCTCCCAAAGATGGTGGTTATGCCGA
GTATCCTGAA
GGGGTCGCCGGCATGAAGGCTCGCATGCGCGGCGAAAAGTTTAAGGAGCATTTCAACCATGCGCAGCTGTTCTACAATTCACTCGCCGAGTATGAGAGACAGCATCTCATCAACGCGATT
TCGTTCGAGCTTTCGCACTGCGACGACCCAGTAGTTTATGAATCGTACATCAAGGTGCTCCACAACGTCGACCTCAACCTCGCAAAACAGGTCAAGATTAACGTCGGCGGCTCTGATGTC
GACTCTAAGGAGCCCGCGCGCGATAATCATGGAAAATCGACGCCGACATTGTCGCAGCTGTATTACGCACCAAAGGAGCCTACTATCAAGTCACGCCGCATCGCGATCCTTGTCGCCGAC
GGCTTCGACCTCGCACAAGTTGAGGGTCTACGCGCCGCCATCAAAGCGGGTATGGCGACCTCCTGGATCATTGGCCCTCGCCGCGGCTGGATATATCCCGAAGATGTCGATGTTGGCTCC
AAGATGCGCGGCGTGTGGGCAGATCATCACTTCGAGGGACAACGCAGCACGCTGTTCGACGCGTTCATCGTTCCTGATGGACGCAAGAGTGCTGAGACGCTTGCTGAGAATGGTCGTACC
ATTCACTGGATCCGGGAGGCGTTTGGCCATTGCAAGGCTATTGGTGCTATTGGCGAAG
GTGTCTCCTTTTTACGCGAGGCCGTCATGCTCCCAGGTATCGAGTACAATACGAAATTGGAC
AGCGACGAAGTTGTCACCTCGTTCGGCGTCGTCACCGTCGGCAAAGTCAGCACCTCTACACTCGCTGCGGACACCCTCAAAATTGCCGAAGGCGAGAAGAACTTCGTGTCCACGTTTGCG
TACGAGGTCAGCAAGCACCGGTGCTACGAGCGCGAGCTCAAGGGCTTAACCAAGAAGGTTGCGTATTGA

Retrieve as FASTA