Entry information : PcarKat05
Entry ID 9959
Creation 2011-12-14 (Christophe Dunand)
Last sequence changes 2011-12-14 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-04-06 (Catherine Mathe (Scipio))
Peroxidase information: PcarKat05
Name PcarKat05
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phanerochaete
Organism Phanerochaete carnosa    [TaxId: 231932 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PcarKat05
start..stop
S start..stop
PcKat05 1414 0 1..740 1..739
PcKat04 1345 0 1..740 1..740
PcarKat04 1342 0 1..740 1..742
PplKat03 1226 0 19..740 19..743
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2528838..2528980 143 N° 2 2529037..2529134 98 N° 3 2529187..2529347 161 N° 4 2529410..2529488 79
N° 5 2529546..2529884 339 N° 6 2529937..2530426 490 N° 7 2530482..2531143 662 N° 8 2531197..2531447 251
join(2528838..2528980,2529037..2529134,2529187..2529347,2529410..2529488,2529546 ..2529884,2529937..2530426,2530482..2531143,2531197..2531447)


exon

Literature and cross-references PcarKat05
DNA ref. JGI genome:   scaffold_1 (2528838..2531447)
Protein sequence: PcarKat05
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   740
PWM (Da):   %s   82389.55  
PI (pH):   %s   6.39
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSLTGALKEKVTAVAQTKKIADLQKDILKQENYLSNDHGVLVSDTDNWLKASDGTHTGPSLLEDQIAREKIHRFDHERIERVVHARGAGAHGYFKVYSDAAKKYTYASVLTDPSRTTPTFVRFSTVQGSKGSDTVRDVRGFATKFYTDEGNWDIVGNDIPVFFIQDAIKFPDIIHAVKPEPHNEVPQGQSAHNNFWDFAGLQPETAHMVMWVMSDRGIPRSYRMMQGFGVNTYTLVNASGERFFVKFHWLPELGVHSLVWDEALKIAGQDPDFHRKDLEEAITNGASPKWQFAIQVIPEANEHDFDFDILDATKVWPEELVPLEVIGEMVLNRNADEFFPEVEQVAFCTSHVVPGIGFSDDPLLQGRNFSYFDTQISRLGINWEELPINRPVCPVMNFNRDGKMRHKIYQGTLNYWPNRAGQFKPVPCEEGGYYDYNQKVAGMKARVRGAKFQEHFNQAQLFYNSLTDYEKQHLISAISFELSHCDDPVVYETYTKLLNNIDFNLAKQVAINVGGVVPEEPARANHGKATPTLSQLYYAPKEPTIKSRRIAILVADGFDLALVEGLRAAIKAGMATSWIIGPRRGWVYPDGAEVGSGKGGVWADHHLEGQRSTLFDAFIVPSGRKSAEALAGNGRAIHWIREAFGHCKAIGAIGGVLFLREAVMLPGVEYNTDLNSDDVVSSLGVVTVGKVSTSTIAADTLKIAQDKKGFVSSFAHEVSKHRCYERELMGLTTKVAY

Retrieve as FASTA  
Remarks complete sequence from genomic (7 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCTTGACCGGTGCCCTCAAGGAAAAGGTCACTGCCGTCGCGCAGACGAAGAAAATCGCAGACTTGCAGAAAGATATCCTCAAGCAGGAGAACTACCTCAGCAACGACCATGGCGTG
CTGGTCTCAGACACCGACAACTG
GTAAATAAATCTCACGCCACACTGCGCGACGTCATGCGCTGACCGTGTCTGCGCAGGCTGAAGGCGTCAGACGGCACTCACACCGGACCGTCGCTGC
TCGAGGACCAGATCGCCCGCGAGAAGATTCACCGGTTCGACCACGAGCGTATTCCTG
GTAAAGCGGTTTATTGGCTTCGAGTCCGACGCTGCTGAGCGTGCCCTACTAGAGCGTGTCGTC
CACGCCCGCGGCGCCGGTGCGCACGGGTATTTCAAGGTGTACAGTGATGCCGCGAAGAAGTACACCTATGCTTCCGTCCTCACCGATCCGTCGCGCACTACACCGACGTTCGTCCGCTTC
AGTACTGTGCAGGGCTCCAAAGGCAGTGCT
GTGAGTATCTCAAAAATTTTTGCGTGGGATTGCCTTGGTAGATCTTCAACAACATTATTCAGGATACTGTCCGAGATGTCCGAGGCTTTG
CCACCAAATTTTACACTGACGAGGGCAACTGGGACATCGTCGGAAACGACA
GTGAGTTCCATATTGCGCAATGTCCCCTAACAGTCATATTATTGACTTTCCTCGTAGTCCCTGTGTTCT
TCATCCAGGATGCCATCAAGTTCCCCGACATCATTCACGCTGTCAAGCCTGAGCCCCATAACGAGGTTCCCCAAGGCCAGAGTGCGCACAATAACTTCTGGGACTTCGCCGGGCTCCAGC
CCGAGACTGCACATATGGTTATGTGGGTTATGTCTGACCGCGGTATCCCTCGCTCGTACCGCATGATGCAGGGCTTCGGTGTCAACACCTACACTCTCGTCAATGCTTCTGGCGAACGCT
TCTTCGTGAAGTTCCACTGGCTTCCCGAGCTTGGTGTCCACAGCCTGGTCTGGGACGAGGCCCTGAAGATCGCCGGCCAGGATCCTG
GTAAGTTCCATTTAGAAGAAGCGACGTTCTGTT
TTTTAACAATCATATGCAGACTTCCACCGCAAAGATCTCGAGGAGGCGATTACCAATGGAGCGTCCCCCAAGTGGCAGTTTGCCATCCAGGTCATCCCTGAAGCTAACGAGCACGACTTC
GACTTTGACATTCTCGATGCGACCAAGGTCTGGCCCGAAGAGCTCGTTCCCCTCGAGGTCATTGGCGAGATGGTCCTCAACCGCAACGCCGACGAGTTCTTCCCCGAGGTTGAGCAGGTT
GCCTTCTGCACCTCGCACGTTGTGCCAGGCATAGGCTTCAGCGACGACCCTCTCCTGCAGGGCCGCAACTTCTCTTACTTCGATACGCAGATCAGTCGTCTTGGTATCAATTGGGAGGAG
CTTCCGATTAACAGGCCCGTCTGCCCTGTTATGAACTTTAACAGAGACGGCAAGATGAGGCACAAGATCTATCAAGGCACTCTCAACTATTGGCCGAACCGCGCTGGTCAGTTCAAACCC
GTGCCTTGTGAGGAGGGCGGGTACTACGA
GTAGGTTTTAGTGCACATTCATCATGCGAACGTTGATGCTTAACGTGGCCTGCAGCTATAACCAAAAGGTTGCCGGAATGAAGGCCCGCGT
GCGTGGAGCCAAGTTCCAGGAGCACTTTAACCAGGCGCAGCTGTTCTACAACTCGCTCACCGACTACGAGAAGCAGCATCTCATCAGCGCCATCTCGTTTGAGCTGTCGCACTGCGACGA
TCCGGTCGTGTACGAGACCTACACCAAGCTGCTCAACAACATCGACTTCAACCTCGCGAAGCAAGTCGCGATCAACGTCGGCGGCGTCGTTCCTGAGGAGCCCGCGCGCGCGAATCATGG
CAAGGCGACGCCGACGCTCTCGCAGCTGTACTACGCGCCCAAGGAGCCCACGATCAAGTCGCGCCGCATCGCGATCCTCGTCGCGGACGGCTTCGACCTCGCGCTCGTCGAGGGCCTCCG
CGCGGCGATCAAGGCGGGCATGGCCACCTCCTGGATCATCGGCCCCCGCCGCGGCTGGGTGTACCCCGACGGCGCGGAGGTCGGCTCCGGCAAGGGTGGCGTGTGGGCGGACCACCACCT
TGAGGGGCAGCGCAGCACGCTCTTTGACGCGTTCATTGTTCCGAGCGGTCGCAAGAGTGCTGAGGCGCTCGCGGGGAACGGACGTGCTATCCATTGGATTCGGGAGGCCTTTGGCCACTG
CAAGGCCATTGGAGCCATTGGTGAGG
GTAAGCGACTTTTCGGTGGATGAGTATTGTATGAGGCGTTAACGCACTCCCAGGCGTCCTGTTCTTGCGCGAGGCGGTTATGCTCCCTGGAGTC
GAGTACAACACCGACTTGAACAGTGACGATGTTGTCTCCTCGTTGGGCGTCGTCACCGTCGGCAAGGTCAGCACCTCGACGATCGCAGCCGACACGCTCAAGATCGCACAAGACAAGAAG
GGCTTCGTCTCCAGCTTTGCGCACGAAGTCAGCAAGCACCGGTGCTACGAGCGGGAGCTCATGGGATTGACCACCAAGGTCGCTTATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCTTGACCGGTGCCCTCAAGGAAAAGGTCACTGCCGTCGCGCAGACGAAGAAAATCGCAGACTTGCAGAAAGATATCCTCAAGCAGGAGAACTACCTCAGCAACGACCATGGCGTG
CTGGTCTCAGACACCGACAACTG
GCTGAAGGCGTCAGACGGCACTCACACCGGACCGTCGCTGCTCGAGGACCAGATCGCCCGCGAGAAGATTCACCGGTTCGACCACGAGCGTATTCCT
G
AGCGTGTCGTCCACGCCCGCGGCGCCGGTGCGCACGGGTATTTCAAGGTGTACAGTGATGCCGCGAAGAAGTACACCTATGCTTCCGTCCTCACCGATCCGTCGCGCACTACACCGACG
TTCGTCCGCTTCAGTACTGTGCAGGGCTCCAAAGGCAGTGCT
GATACTGTCCGAGATGTCCGAGGCTTTGCCACCAAATTTTACACTGACGAGGGCAACTGGGACATCGTCGGAAACGAC
A
TCCCTGTGTTCTTCATCCAGGATGCCATCAAGTTCCCCGACATCATTCACGCTGTCAAGCCTGAGCCCCATAACGAGGTTCCCCAAGGCCAGAGTGCGCACAATAACTTCTGGGACTTC
GCCGGGCTCCAGCCCGAGACTGCACATATGGTTATGTGGGTTATGTCTGACCGCGGTATCCCTCGCTCGTACCGCATGATGCAGGGCTTCGGTGTCAACACCTACACTCTCGTCAATGCT
TCTGGCGAACGCTTCTTCGTGAAGTTCCACTGGCTTCCCGAGCTTGGTGTCCACAGCCTGGTCTGGGACGAGGCCCTGAAGATCGCCGGCCAGGATCCTG
ACTTCCACCGCAAAGATCTC
GAGGAGGCGATTACCAATGGAGCGTCCCCCAAGTGGCAGTTTGCCATCCAGGTCATCCCTGAAGCTAACGAGCACGACTTCGACTTTGACATTCTCGATGCGACCAAGGTCTGGCCCGAA
GAGCTCGTTCCCCTCGAGGTCATTGGCGAGATGGTCCTCAACCGCAACGCCGACGAGTTCTTCCCCGAGGTTGAGCAGGTTGCCTTCTGCACCTCGCACGTTGTGCCAGGCATAGGCTTC
AGCGACGACCCTCTCCTGCAGGGCCGCAACTTCTCTTACTTCGATACGCAGATCAGTCGTCTTGGTATCAATTGGGAGGAGCTTCCGATTAACAGGCCCGTCTGCCCTGTTATGAACTTT
AACAGAGACGGCAAGATGAGGCACAAGATCTATCAAGGCACTCTCAACTATTGGCCGAACCGCGCTGGTCAGTTCAAACCCGTGCCTTGTGAGGAGGGCGGGTACTACGA
CTATAACCAA
AAGGTTGCCGGAATGAAGGCCCGCGTGCGTGGAGCCAAGTTCCAGGAGCACTTTAACCAGGCGCAGCTGTTCTACAACTCGCTCACCGACTACGAGAAGCAGCATCTCATCAGCGCCATC
TCGTTTGAGCTGTCGCACTGCGACGATCCGGTCGTGTACGAGACCTACACCAAGCTGCTCAACAACATCGACTTCAACCTCGCGAAGCAAGTCGCGATCAACGTCGGCGGCGTCGTTCCT
GAGGAGCCCGCGCGCGCGAATCATGGCAAGGCGACGCCGACGCTCTCGCAGCTGTACTACGCGCCCAAGGAGCCCACGATCAAGTCGCGCCGCATCGCGATCCTCGTCGCGGACGGCTTC
GACCTCGCGCTCGTCGAGGGCCTCCGCGCGGCGATCAAGGCGGGCATGGCCACCTCCTGGATCATCGGCCCCCGCCGCGGCTGGGTGTACCCCGACGGCGCGGAGGTCGGCTCCGGCAAG
GGTGGCGTGTGGGCGGACCACCACCTTGAGGGGCAGCGCAGCACGCTCTTTGACGCGTTCATTGTTCCGAGCGGTCGCAAGAGTGCTGAGGCGCTCGCGGGGAACGGACGTGCTATCCAT
TGGATTCGGGAGGCCTTTGGCCACTGCAAGGCCATTGGAGCCATTGGTGAGG
GCGTCCTGTTCTTGCGCGAGGCGGTTATGCTCCCTGGAGTCGAGTACAACACCGACTTGAACAGTGAC
GATGTTGTCTCCTCGTTGGGCGTCGTCACCGTCGGCAAGGTCAGCACCTCGACGATCGCAGCCGACACGCTCAAGATCGCACAAGACAAGAAGGGCTTCGTCTCCAGCTTTGCGCACGAA
GTCAGCAAGCACCGGTGCTACGAGCGGGAGCTCATGGGATTGACCACCAAGGTCGCTTATTAA

Retrieve as FASTA