Entry information : PcarHalPrx01
Entry ID 9963
Creation 0000-00-00 (Christophe Dunand)
Last sequence changes 2011-12-14 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-06 (Catherine Mathe (Scipio))
Peroxidase information: PcarHalPrx01
Name PcarHalPrx01
Class Haloperoxidase (haem)    [Orthogroup: HalPrx001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phanerochaete
Organism Phanerochaete carnosa    [TaxId: 231932 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PcarHalPrx01
start..stop
S start..stop
PcHalPrx01 510 0 1..296 1..295
PplHalPrx01 378 5e-133 5..284 4..282
PplHalPrx03 378 5e-133 5..284 4..282
PplHalPrx02 372 5e-131 6..281 4..280
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2988446..2988710 265 N° 2 2988974..2989177 204 N° 3 2989236..2989437 202 N° 4 2989491..2989710 220
join(2988446..2988710,2988974..2989177,2989236..2989437,2989491..2989710)


exon

Literature and cross-references PcarHalPrx01
DNA ref. JGI genome:   scaffold_4 (2988446..2989710)
Protein sequence: PcarHalPrx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   296
PWM (Da):   %s   32472.18  
PI (pH):   %s   6.86
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSDSLFVLVSARLLSGLYSSLTSGLLNVGIMVWDSGLAIYNLVTWNLPANAVVPQGCAGALGVWPEYVPPQEGDSRCSCPALNAMANHGILPHSGRGISFKDLSATIRQTYNFAPSFCLFVPNYAANMLCRNYWTDTFDLSDLDVHNCIEHDGSLTREDSVDQPDQGKPVRHLVEELLASGTGPNGDLTPADLSRISGKRRMESKRRNGQFSLTTFHKFFGSSNSSTMLTILGGRVKDLRPFLLEERIPDGWQPRIRHRMGLTMAEFNSTALRVEFGITEEVYGDTSNAAQKKKTL

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Uncorrect prediction from JGI (short PS is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGGACTCGCTGTTCGTTCTTGTTTCCGCAAGGTTGCTCTCCGGCCTGTACTCCTCGCTTACCTCAGGCCTGCTGAATGTCGGAATCATGGTCTGGGACAGCGGACTCGCAATCTAC
AACCTCGTGACCTGGAATCTCCCCGCCAACGCCGTCGTGCCCCAGGGCTGCGCAGGCGCACTTGGGGTGTGGCCCGAGTACGTTCCACCCCAGGAGGGCGATAGTCGATGCTCGTGTCCG
GCGCTGAACGCCATGGCGAATCACG
GTGCGTGGGAACTTGATTGGCGTCCTGTGCTTCTCGGGCCGCGCGCGGGCTGCAGTAATGACTTTGTTCAAATGGACCGAGCTTTTAATACGCTA
TGCTCGTCTTTGTTCGGCTATCCGGGGCGTAGCCTATGTCGCGTGAGCGGACGTGACAAAGACCTGGAAAAGCGCATTTCCGCACCGAAGTAATGTCATGTTCCGCAGCTCGCGTGACCT
ATGTATTCCCCAATTACTTTGACGACGCTAACGGTGCCGGCCCTGCAGGAATCTTGCCCCACTCAGGTCGCGGAATTAGCTTCAAGGACCTATCGGCAACGATTAGACAGACTTACAACT
TTGCCCCAAGCTTTTGCCTCTTCGTCCCCAACTATGCCGCGAACATGCTGTGCCGCAACTACTGGACTGACACCTTCGATTTGAGCGACCTTGACGTACATAATTGCATTGAGCACGATG
GGTCCTTGACTC
GTACGTGCATTTACATGAAATGGTCCAGTGATAGGGCACCTACGTCATTTGTTTGCAGGCGAGGACAGCGTCGACCAGCCTGACCAAGGAAAGCCGGTTCGGCATCTT
GTCGAGGAGTTGCTGGCGTCCGGTACAGGTCCCAACGGAGACCTTACCCCAGCAGATCTCTCGCGCATCTCCGGGAAGAGGCGCATGGAGTCCAAGAGGAGGAACGGACAATTTAGCCTC
ACGACCTTCCACAAGTTTTTCGGCAGTTCCAA
GTGAGCACAGTTCATGTACTCTGATCGTGCTCCTCAAATTAATGACTTGGCAGCTCTTCCACGATGCTGACGATCCTCGGAGGCAGAG
TGAAGGATCTGCGCCCCTTTCTCCTGGAGGAGCGCATTCCGGACGGCTGGCAGCCACGAATCCGGCATCGTATGGGGCTGACCATGGCGGAGTTCAACAGCACCGCGTTGCGGGTCGAGT
TTGGGATCACGGAAGAAGTATACGGGGACACGTCAAATGCCGCACAAAAGAAGAAGACACTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGGACTCGCTGTTCGTTCTTGTTTCCGCAAGGTTGCTCTCCGGCCTGTACTCCTCGCTTACCTCAGGCCTGCTGAATGTCGGAATCATGGTCTGGGACAGCGGACTCGCAATCTAC
AACCTCGTGACCTGGAATCTCCCCGCCAACGCCGTCGTGCCCCAGGGCTGCGCAGGCGCACTTGGGGTGTGGCCCGAGTACGTTCCACCCCAGGAGGGCGATAGTCGATGCTCGTGTCCG
GCGCTGAACGCCATGGCGAATCACG
GAATCTTGCCCCACTCAGGTCGCGGAATTAGCTTCAAGGACCTATCGGCAACGATTAGACAGACTTACAACTTTGCCCCAAGCTTTTGCCTCTTC
GTCCCCAACTATGCCGCGAACATGCTGTGCCGCAACTACTGGACTGACACCTTCGATTTGAGCGACCTTGACGTACATAATTGCATTGAGCACGATGGGTCCTTGACTC
GCGAGGACAGC
GTCGACCAGCCTGACCAAGGAAAGCCGGTTCGGCATCTTGTCGAGGAGTTGCTGGCGTCCGGTACAGGTCCCAACGGAGACCTTACCCCAGCAGATCTCTCGCGCATCTCCGGGAAGAGG
CGCATGGAGTCCAAGAGGAGGAACGGACAATTTAGCCTCACGACCTTCCACAAGTTTTTCGGCAGTTCCAA
CTCTTCCACGATGCTGACGATCCTCGGAGGCAGAGTGAAGGATCTGCGC
CCCTTTCTCCTGGAGGAGCGCATTCCGGACGGCTGGCAGCCACGAATCCGGCATCGTATGGGGCTGACCATGGCGGAGTTCAACAGCACCGCGTTGCGGGTCGAGTTTGGGATCACGGAA
GAAGTATACGGGGACACGTCAAATGCCGCACAAAAGAAGAAGACACTGTAA

Retrieve as FASTA